EMAIL THIS PAGE TO A FRIEND

PPFIA4

protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 4

UniProtKB ID: O75335, A2RUJ5, B1APN8, O94971
Gene ID:
Human(8497) Summary: PPFIA4, or liprin-alpha-4, belongs to the liprin-alpha gene family. See liprin-alpha-1 (LIP1, or PPFIA1; MIM 611054) for background on liprins.[supplied by OMIM, Mar 2008]
Mouse(68507) protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 4
Rat(140592) protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 4
Zebrafish(100005543) protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 4
Horse(100065130) protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 4
domestic cat(101080938) protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 4
dog(606840) protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 4
chicken(421155) protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 4
cow(539793) protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 4
sheep(101106189) protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 4
domestic guinea pig(100727699) protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 4
naked mole-rat(101707302) protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 4
98 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001144855 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001144855 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001144855 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-XM_046751 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_046751 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_046751 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU154921 MISSION® esiRNA esiRNA targeting mouse Ppfia4 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015053 Rosetta Predictions human pricing
XM_001061955 Rosetta Predictions rat pricing
XM_573454 Rosetta Predictions rat pricing
XM_129443 Rosetta Predictions mouse pricing
XM_988391 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015053 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00014253 predicted 2151
2 SASI_Hs01_00014254 predicted 2623
3 SASI_Hs01_00014255 predicted 1479
4 SASI_Hs01_00014256 predicted 1867
5 SASI_Hs01_00014257 predicted 2252
6 SASI_Hs01_00014258 predicted 984
7 SASI_Hs01_00014259 predicted 947
8 SASI_Hs01_00014261 predicted 1562
9 SASI_Hs01_00014262 predicted 2782
10 SASI_Hs02_00346902 predicted 2655
11 SASI_Hs01_00014260 predicted 1213
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001061955 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00301914 predicted 2779
2 SASI_Rn02_00301915 predicted 2690
3 SASI_Rn02_00301916 predicted 3391
4 SASI_Rn02_00301917 predicted 1399
5 SASI_Rn02_00301918 predicted 3010
6 SASI_Rn02_00301919 predicted 2885
7 SASI_Rn02_00301920 predicted 2920
8 SASI_Rn02_00301921 predicted 1458
9 SASI_Rn02_00301922 predicted 3170
10 SASI_Rn02_00301923 predicted 799
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_573454 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00400314 predicted 2779
2 SASI_Rn02_00400315 predicted 2685
3 SASI_Rn02_00400316 predicted 3395
4 SASI_Rn02_00400317 predicted 1403
5 SASI_Rn02_00400318 predicted 3007
6 SASI_Rn02_00400319 predicted 2883
7 SASI_Rn02_00400320 predicted 2917
8 SASI_Rn02_00400321 predicted 1457
9 SASI_Rn02_00400322 predicted 3170
10 SASI_Rn02_00400323 predicted 799
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_129443 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00234087 predicted 2918
2 SASI_Mm01_00234088 predicted 2931
3 SASI_Mm01_00234089 predicted 1458
4 SASI_Mm01_00234091 predicted 2781
5 SASI_Mm01_00234092 predicted 308
6 SASI_Mm01_00234093 predicted 1987
7 SASI_Mm01_00234094 predicted 3006
8 SASI_Mm01_00234095 predicted 2880
9 SASI_Mm01_00234096 predicted 2381
10 SASI_Mm02_00424308 predicted 1404
11 SASI_Mm01_00234090 predicted 1405
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_988391 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00449628 predicted 2917
2 SASI_Mm02_00449629 predicted 1461
3 SASI_Mm02_00449630 predicted 2776
4 SASI_Mm02_00449631 predicted 304
5 SASI_Mm02_00449632 predicted 1987
6 SASI_Mm02_00449633 predicted 3001
7 SASI_Mm02_00449634 predicted 2887
8 SASI_Mm02_00449635 predicted 2380
9 SASI_Mm02_00449636 predicted 1397
10 SASI_Mm02_00449637 predicted 797
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001144855
PPFIA4 MISSION shRNA Bacterial Glycerol Stock
protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 4
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000376341    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001144855.1-4437s21c1
Sequence:CCGGTGAGATGACCCTTCCAATAAACTCGAGTTTATTGGAAGGGTCATCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144855.1-3533s21c1
Sequence:CCGGCTATAGGGCTAAGGGACTATGCTCGAGCATAGTCCCTTAGCCCTATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342144    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144855.1-1916s21c1
Sequence:CCGGCAGGTCTGCATCGACGCTATTCTCGAGAATAGCGTCGATGCAGACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342143    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144855.1-714s21c1
Sequence:CCGGGCTGAAAGCAGAGCGGAATAACTCGAGTTATTCCGCTCTGCTTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342142    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001144855.1-4306s21c1
Sequence:CCGGCACCCAGGTTGTAGGTGTTTGCTCGAGCAAACACCTACAACCTGGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000352662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144855.1-860s21c1
Sequence:CCGGAGGCCCTCAAGTCACTATTTGCTCGAGCAAATAGTGACTTGAGGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144855.1-3415s21c1
Sequence:CCGGTGTCTGAAGAGGCTGAATTATCTCGAGATAATTCAGCCTCTTCAGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001144855
PPFIA4 MISSION shRNA shRNA Plasmid DNA
protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 4
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000376341    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001144855.1-4437s21c1
Sequence:CCGGTGAGATGACCCTTCCAATAAACTCGAGTTTATTGGAAGGGTCATCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144855.1-3533s21c1
Sequence:CCGGCTATAGGGCTAAGGGACTATGCTCGAGCATAGTCCCTTAGCCCTATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342144    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144855.1-1916s21c1
Sequence:CCGGCAGGTCTGCATCGACGCTATTCTCGAGAATAGCGTCGATGCAGACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342143    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144855.1-714s21c1
Sequence:CCGGGCTGAAAGCAGAGCGGAATAACTCGAGTTATTCCGCTCTGCTTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342142    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001144855.1-4306s21c1
Sequence:CCGGCACCCAGGTTGTAGGTGTTTGCTCGAGCAAACACCTACAACCTGGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000352662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144855.1-860s21c1
Sequence:CCGGAGGCCCTCAAGTCACTATTTGCTCGAGCAAATAGTGACTTGAGGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144855.1-3415s21c1
Sequence:CCGGTGTCTGAAGAGGCTGAATTATCTCGAGATAATTCAGCCTCTTCAGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001144855
PPFIA4 MISSION shRNA Lentiviral Transduction Particles
protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 4
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000376341    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001144855.1-4437s21c1
Sequence:CCGGTGAGATGACCCTTCCAATAAACTCGAGTTTATTGGAAGGGTCATCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144855.1-3533s21c1
Sequence:CCGGCTATAGGGCTAAGGGACTATGCTCGAGCATAGTCCCTTAGCCCTATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342144    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144855.1-1916s21c1
Sequence:CCGGCAGGTCTGCATCGACGCTATTCTCGAGAATAGCGTCGATGCAGACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342143    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144855.1-714s21c1
Sequence:CCGGGCTGAAAGCAGAGCGGAATAACTCGAGTTATTCCGCTCTGCTTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342142    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001144855.1-4306s21c1
Sequence:CCGGCACCCAGGTTGTAGGTGTTTGCTCGAGCAAACACCTACAACCTGGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000352662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144855.1-860s21c1
Sequence:CCGGAGGCCCTCAAGTCACTATTTGCTCGAGCAAATAGTGACTTGAGGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001144855.1-3415s21c1
Sequence:CCGGTGTCTGAAGAGGCTGAATTATCTCGAGATAATTCAGCCTCTTCAGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_046751
PPFIA4 MISSION shRNA Bacterial Glycerol Stock
protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 4
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000052694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_046751.6-3021s1c1
Sequence:CCGGGCATGAGATCAAGGATGTGTTCTCGAGAACACATCCTTGATCTCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_046751.6-3439s1c1
Sequence:CCGGCCAAAGAAGATCATGCCTGAACTCGAGTTCAGGCATGATCTTCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_046751.6-1960s1c1
Sequence:CCGGCCCAGTGACTTAAGAAAGCATCTCGAGATGCTTTCTTAAGTCACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_046751.6-289s1c1
Sequence:CCGGCGGGAGGAAGAGATATCAGAACTCGAGTTCTGATATCTCTTCCTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_046751.6-1458s1c1
Sequence:CCGGCCTGTCTGAAGAGATTGAGAACTCGAGTTCTCAATCTCTTCAGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_046751.6-3439s1c2
Sequence:CCGGCCAAAGAAGATCATGCCTGAACTCGAGTTCAGGCATGATCTTCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_046751
PPFIA4 MISSION shRNA shRNA Plasmid DNA
protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 4
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000052694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_046751.6-3021s1c1
Sequence:CCGGGCATGAGATCAAGGATGTGTTCTCGAGAACACATCCTTGATCTCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_046751.6-3439s1c1
Sequence:CCGGCCAAAGAAGATCATGCCTGAACTCGAGTTCAGGCATGATCTTCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_046751.6-1960s1c1
Sequence:CCGGCCCAGTGACTTAAGAAAGCATCTCGAGATGCTTTCTTAAGTCACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_046751.6-289s1c1
Sequence:CCGGCGGGAGGAAGAGATATCAGAACTCGAGTTCTGATATCTCTTCCTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_046751.6-1458s1c1
Sequence:CCGGCCTGTCTGAAGAGATTGAGAACTCGAGTTCTCAATCTCTTCAGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_046751.6-3439s1c2
Sequence:CCGGCCAAAGAAGATCATGCCTGAACTCGAGTTCAGGCATGATCTTCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_046751
PPFIA4 MISSION shRNA Lentiviral Transduction Particles
protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 4
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000052694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_046751.6-3021s1c1
Sequence:CCGGGCATGAGATCAAGGATGTGTTCTCGAGAACACATCCTTGATCTCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_046751.6-3439s1c1
Sequence:CCGGCCAAAGAAGATCATGCCTGAACTCGAGTTCAGGCATGATCTTCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_046751.6-1960s1c1
Sequence:CCGGCCCAGTGACTTAAGAAAGCATCTCGAGATGCTTTCTTAAGTCACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_046751.6-289s1c1
Sequence:CCGGCGGGAGGAAGAGATATCAGAACTCGAGTTCTGATATCTCTTCCTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_046751.6-1458s1c1
Sequence:CCGGCCTGTCTGAAGAGATTGAGAACTCGAGTTCTCAATCTCTTCAGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_046751.6-3439s1c2
Sequence:CCGGCCAAAGAAGATCATGCCTGAACTCGAGTTCAGGCATGATCTTCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks