EMAIL THIS PAGE TO A FRIEND

PPFIBP2

PTPRF interacting protein, binding protein 2 (liprin beta 2)

Synonyms: Cclp1
UniProtKB ID: Q8ND30, B7Z433, E9PK77, O75337, Q8WW26
Gene ID:
Human(8495) Summary: This gene encodes a member of the LAR protein-tyrosine phosphatase-interacting protein (liprin) family. The encoded protein is a beta liprin and plays a role in axon guidance and neuronal synapse development by recruiting LAR protein-tyrosine phosphatases to the plasma membrane. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Feb 2012]
Mouse(19024) PTPRF interacting protein, binding protein 2 (liprin beta 2)
Rat(308918) PTPRF interacting protein, binding protein 2 (liprin beta 2)
chicken(428843) PTPRF interacting protein, binding protein 2 (liprin beta 2)
Horse(100055386) PTPRF interacting protein, binding protein 2 (liprin beta 2)
domestic cat(101082090) PTPRF interacting protein, binding protein 2 (liprin beta 2)
dog(485366) PTPRF interacting protein, binding protein 2 (liprin beta 2)
cow(614705) PTPRF interacting protein, binding protein 2 (liprin beta 2)
sheep(101111828) PTPRF interacting protein, binding protein 2 (liprin beta 2)
domestic guinea pig(100723499) PTPRF interacting protein, binding protein 2 (liprin beta 2)
Domestic Rabbit(100343948) PTPRF interacting protein, binding protein 2 (liprin beta 2)
naked mole-rat(101712228) PTPRF interacting protein, binding protein 2 (liprin beta 2)
111 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008905 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008905 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008905 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003621 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003621 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003621 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU030791 MISSION® esiRNA esiRNA human PPFIBP2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003621 Rosetta Predictions human pricing
XM_001072388 Rosetta Predictions rat pricing
XM_001072553 Rosetta Predictions rat pricing
XM_219201 Rosetta Predictions rat pricing
NM_008905 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003621 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00069062 predicted 2443
2 SASI_Hs01_00069063 predicted 2354
3 SASI_Hs01_00069064 predicted 1455
4 SASI_Hs01_00069066 predicted 2377
5 SASI_Hs01_00069068 predicted 2921
6 SASI_Hs01_00069069 predicted 1814
7 SASI_Hs01_00069070 predicted 2084
8 SASI_Hs01_00069071 predicted 2570
9 SASI_Hs02_00335967 predicted 1680
10 SASI_Hs02_00335968 predicted 1663
11 SASI_Hs01_00069065 predicted 2459
12 SASI_Hs01_00069067 predicted 2257
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001072388 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00338979 predicted 758
2 SASI_Rn02_00338980 predicted 1951
3 SASI_Rn02_00338981 predicted 958
4 SASI_Rn02_00338982 predicted 2116
5 SASI_Rn02_00338983 predicted 404
6 SASI_Rn02_00338984 predicted 806
7 SASI_Rn02_00338985 predicted 1478
8 SASI_Rn02_00338986 predicted 2274
9 SASI_Rn02_00338987 predicted 1588
10 SASI_Rn02_00338988 predicted 1306
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001072553 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00339648 predicted 552
2 SASI_Rn02_00339649 predicted 1177
3 SASI_Rn02_00339650 predicted 451
4 SASI_Rn02_00339651 predicted 2400
5 SASI_Rn02_00339652 predicted 1374
6 SASI_Rn02_00339653 predicted 2559
7 SASI_Rn02_00339654 predicted 1217
8 SASI_Rn02_00339655 predicted 1925
9 SASI_Rn02_00339656 predicted 2726
10 SASI_Rn02_00339657 predicted 209
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_219201 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00378317 predicted 753
2 SASI_Rn02_00378318 predicted 1953
3 SASI_Rn02_00378319 predicted 959
4 SASI_Rn02_00378320 predicted 2110
5 SASI_Rn02_00378321 predicted 406
6 SASI_Rn02_00378322 predicted 799
7 SASI_Rn02_00378323 predicted 1482
8 SASI_Rn02_00378324 predicted 2268
9 SASI_Rn02_00378325 predicted 1588
10 SASI_Rn02_00378326 predicted 1307
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008905 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00134200 predicted 2326
2 SASI_Mm01_00134201 predicted 1569
3 SASI_Mm01_00134202 predicted 386
4 SASI_Mm01_00134204 predicted 1690
5 SASI_Mm01_00134205 predicted 1115
6 SASI_Mm01_00134207 predicted 2072
7 SASI_Mm02_00314925 predicted 2142
8 SASI_Mm01_00134208 predicted 484
9 SASI_Mm01_00134209 predicted 1905
10 SASI_Mm02_00314926 predicted 1439
11 SASI_Mm01_00134203 predicted 2219
12 SASI_Mm01_00134206 predicted 2165
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008905
VALIDATED
PPFIBP2 MISSION shRNA Bacterial Glycerol Stock
PTPRF interacting protein, binding protein 2 (liprin beta 2)
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000353485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008905.1-2206s21c1
Sequence:CCGGCTCAGCATCAAATGTGCTATTCTCGAGAATAGCACATTTGATGCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345411    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008905.2-1750s21c1
Sequence:CCGGGTGTCAGTGCTCCCGTATTAGCTCGAGCTAATACGGGAGCACTGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008905.1-384s21c1
Sequence:CCGGCCCAACAGCTACCTACATAAACTCGAGTTTATGTAGGTAGCTGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008905.1-1534s21c1
Sequence:CCGGAGTGTCAGTGCTCCCGTATTACTCGAGTAATACGGGAGCACTGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008905.1-440s21c1
Sequence:CCGGACCACGGTGCTGCTAGTAATGCTCGAGCATTACTAGCAGCACCGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328555    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008905.1-3026s21c1
Sequence:CCGGGCAGACATTAGTAGATGTTTACTCGAGTAAACATCTACTAATGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029864    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008905.1-3026s1c1
Sequence:CCGGGCAGACATTAGTAGATGTTTACTCGAGTAAACATCTACTAATGTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008905.1-2206s1c1
Sequence:CCGGCTCAGCATCAAATGTGCTATTCTCGAGAATAGCACATTTGATGCTGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029868    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008905.1-481s1c1
Sequence:CCGGGCACGGCTAGAAGGAGATAAACTCGAGTTTATCTCCTTCTAGCCGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008905.1-1571s1c1
Sequence:CCGGGCTGGGAAGATATAGTCTCATCTCGAGATGAGACTATATCTTCCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008905.1-384s1c1
Sequence:CCGGCCCAACAGCTACCTACATAAACTCGAGTTTATGTAGGTAGCTGTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008905
VALIDATED
PPFIBP2 MISSION shRNA shRNA Plasmid DNA
PTPRF interacting protein, binding protein 2 (liprin beta 2)
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000353485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008905.1-2206s21c1
Sequence:CCGGCTCAGCATCAAATGTGCTATTCTCGAGAATAGCACATTTGATGCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345411    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008905.2-1750s21c1
Sequence:CCGGGTGTCAGTGCTCCCGTATTAGCTCGAGCTAATACGGGAGCACTGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008905.1-384s21c1
Sequence:CCGGCCCAACAGCTACCTACATAAACTCGAGTTTATGTAGGTAGCTGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008905.1-1534s21c1
Sequence:CCGGAGTGTCAGTGCTCCCGTATTACTCGAGTAATACGGGAGCACTGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008905.1-440s21c1
Sequence:CCGGACCACGGTGCTGCTAGTAATGCTCGAGCATTACTAGCAGCACCGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328555    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008905.1-3026s21c1
Sequence:CCGGGCAGACATTAGTAGATGTTTACTCGAGTAAACATCTACTAATGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029864    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008905.1-3026s1c1
Sequence:CCGGGCAGACATTAGTAGATGTTTACTCGAGTAAACATCTACTAATGTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008905.1-2206s1c1
Sequence:CCGGCTCAGCATCAAATGTGCTATTCTCGAGAATAGCACATTTGATGCTGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029868    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008905.1-481s1c1
Sequence:CCGGGCACGGCTAGAAGGAGATAAACTCGAGTTTATCTCCTTCTAGCCGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008905.1-1571s1c1
Sequence:CCGGGCTGGGAAGATATAGTCTCATCTCGAGATGAGACTATATCTTCCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008905.1-384s1c1
Sequence:CCGGCCCAACAGCTACCTACATAAACTCGAGTTTATGTAGGTAGCTGTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008905
VALIDATED
PPFIBP2 MISSION shRNA Lentiviral Transduction Particles
PTPRF interacting protein, binding protein 2 (liprin beta 2)
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000353485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008905.1-2206s21c1
Sequence:CCGGCTCAGCATCAAATGTGCTATTCTCGAGAATAGCACATTTGATGCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345411    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008905.2-1750s21c1
Sequence:CCGGGTGTCAGTGCTCCCGTATTAGCTCGAGCTAATACGGGAGCACTGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008905.1-384s21c1
Sequence:CCGGCCCAACAGCTACCTACATAAACTCGAGTTTATGTAGGTAGCTGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008905.1-1534s21c1
Sequence:CCGGAGTGTCAGTGCTCCCGTATTACTCGAGTAATACGGGAGCACTGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008905.1-440s21c1
Sequence:CCGGACCACGGTGCTGCTAGTAATGCTCGAGCATTACTAGCAGCACCGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328555    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008905.1-3026s21c1
Sequence:CCGGGCAGACATTAGTAGATGTTTACTCGAGTAAACATCTACTAATGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029864    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008905.1-3026s1c1
Sequence:CCGGGCAGACATTAGTAGATGTTTACTCGAGTAAACATCTACTAATGTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008905.1-2206s1c1
Sequence:CCGGCTCAGCATCAAATGTGCTATTCTCGAGAATAGCACATTTGATGCTGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029868    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008905.1-481s1c1
Sequence:CCGGGCACGGCTAGAAGGAGATAAACTCGAGTTTATCTCCTTCTAGCCGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008905.1-1571s1c1
Sequence:CCGGGCTGGGAAGATATAGTCTCATCTCGAGATGAGACTATATCTTCCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008905.1-384s1c1
Sequence:CCGGCCCAACAGCTACCTACATAAACTCGAGTTTATGTAGGTAGCTGTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003621
VALIDATED
PPFIBP2 MISSION shRNA Bacterial Glycerol Stock
PTPRF interacting protein, binding protein 2 (liprin beta 2)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000288875    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_003621.2-3119s21c1
Sequence:CCGGGCAGAGAATATTCCAGCAATTCTCGAGAATTGCTGGAATATTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003621.2-624s21c1
Sequence:CCGGGCCCAACAGCTGCCTACATAACTCGAGTTATGTAGGCAGCTGTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296068    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003621.2-737s21c1
Sequence:CCGGGATAAGGAGTCCCTCATATTGCTCGAGCAATATGAGGGACTCCTTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003621.2-429s21c1
Sequence:CCGGAGCAAATGGACGGGATCATTGCTCGAGCAATGATCCCGTCCATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308073    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_003621.2-2375s21c1
Sequence:CCGGTACCTAACTGTGAACGATTTACTCGAGTAAATCGTTCACAGTTAGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122435    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003621.1-1221s1c1
Sequence:CCGGGAAGATAAGGACCGTCGGATACTCGAGTATCCGACGGTCCTTATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003621.1-2054s1c1
Sequence:CCGGCCTGGCTCAGTATGTGATCTTCTCGAGAAGATCACATACTGAGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116152    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003621.1-3072s1c1
Sequence:CCGGGCAGAGAATATTCCAGCAATTCTCGAGAATTGCTGGAATATTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_003621.1-2408s1c1
Sequence:CCGGGCTGCATGTCAACAAGTTCAACTCGAGTTGAACTTGTTGACATGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003621.1-1371s1c1
Sequence:CCGGGCTACAAATAAGGACCCTGAACTCGAGTTCAGGGTCCTTATTTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003621
VALIDATED
PPFIBP2 MISSION shRNA shRNA Plasmid DNA
PTPRF interacting protein, binding protein 2 (liprin beta 2)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000288875    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_003621.2-3119s21c1
Sequence:CCGGGCAGAGAATATTCCAGCAATTCTCGAGAATTGCTGGAATATTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003621.2-624s21c1
Sequence:CCGGGCCCAACAGCTGCCTACATAACTCGAGTTATGTAGGCAGCTGTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296068    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003621.2-737s21c1
Sequence:CCGGGATAAGGAGTCCCTCATATTGCTCGAGCAATATGAGGGACTCCTTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003621.2-429s21c1
Sequence:CCGGAGCAAATGGACGGGATCATTGCTCGAGCAATGATCCCGTCCATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308073    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_003621.2-2375s21c1
Sequence:CCGGTACCTAACTGTGAACGATTTACTCGAGTAAATCGTTCACAGTTAGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122435    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003621.1-1221s1c1
Sequence:CCGGGAAGATAAGGACCGTCGGATACTCGAGTATCCGACGGTCCTTATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003621.1-2054s1c1
Sequence:CCGGCCTGGCTCAGTATGTGATCTTCTCGAGAAGATCACATACTGAGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116152    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003621.1-3072s1c1
Sequence:CCGGGCAGAGAATATTCCAGCAATTCTCGAGAATTGCTGGAATATTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_003621.1-2408s1c1
Sequence:CCGGGCTGCATGTCAACAAGTTCAACTCGAGTTGAACTTGTTGACATGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003621.1-1371s1c1
Sequence:CCGGGCTACAAATAAGGACCCTGAACTCGAGTTCAGGGTCCTTATTTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003621
VALIDATED
PPFIBP2 MISSION shRNA Lentiviral Transduction Particles
PTPRF interacting protein, binding protein 2 (liprin beta 2)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000288875    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_003621.2-3119s21c1
Sequence:CCGGGCAGAGAATATTCCAGCAATTCTCGAGAATTGCTGGAATATTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003621.2-624s21c1
Sequence:CCGGGCCCAACAGCTGCCTACATAACTCGAGTTATGTAGGCAGCTGTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296068    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003621.2-737s21c1
Sequence:CCGGGATAAGGAGTCCCTCATATTGCTCGAGCAATATGAGGGACTCCTTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003621.2-429s21c1
Sequence:CCGGAGCAAATGGACGGGATCATTGCTCGAGCAATGATCCCGTCCATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308073    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_003621.2-2375s21c1
Sequence:CCGGTACCTAACTGTGAACGATTTACTCGAGTAAATCGTTCACAGTTAGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122435    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003621.1-1221s1c1
Sequence:CCGGGAAGATAAGGACCGTCGGATACTCGAGTATCCGACGGTCCTTATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003621.1-2054s1c1
Sequence:CCGGCCTGGCTCAGTATGTGATCTTCTCGAGAAGATCACATACTGAGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116152    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003621.1-3072s1c1
Sequence:CCGGGCAGAGAATATTCCAGCAATTCTCGAGAATTGCTGGAATATTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_003621.1-2408s1c1
Sequence:CCGGGCTGCATGTCAACAAGTTCAACTCGAGTTGAACTTGTTGACATGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003621.1-1371s1c1
Sequence:CCGGGCTACAAATAAGGACCCTGAACTCGAGTTCAGGGTCCTTATTTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks