EMAIL THIS PAGE TO A FRIEND

PPIAL4B

peptidylprolyl isomerase A (cyclophilin A)-like 4B

Synonyms: COAS-2
Species: Human PPIAL4B(653505)
Gene ID:
13 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4200674 Monoclonal Anti-PPIAL4 antibody produced in mouse clone PP-8, purified from hybridoma cell culture human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001143883 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001143883 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001143883 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_927767 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_927767 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00256729 predicted 812
2 SASI_Hs01_00256730 predicted 805
3 SASI_Hs01_00256731 predicted 809
4 SASI_Hs01_00256732 predicted 670
5 SASI_Hs01_00256733 predicted 676
6 SASI_Hs01_00256734 predicted 839
7 SASI_Hs01_00256735 predicted 840
8 SASI_Hs01_00256736 predicted 840
9 SASI_Hs01_00256737 predicted 895
10 SASI_Hs01_00256738 predicted 895
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001143883
PPIAL4B MISSION shRNA Bacterial Glycerol Stock
peptidylprolyl isomerase A (cyclophilin A)-like 4B
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000377627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143883.2-361s21c1
Sequence:CCGGGGCATCTTGTCCATGGCAAATCTCGAGATTTGCCATGGACAAGATGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143883.2-469s21c1
Sequence:CCGGGTGAAAGAACGTGTGAATATTCTCGAGAATATTCACACGTTCTTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143883.1-584s21c1
Sequence:CCGGAGAATTATTCCAGGGTTTATGCTCGAGCATAAACCCTGGAATAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143883.1-615s21c1
Sequence:CCGGGTGACTTCACACGCCATAATGCTCGAGCATTATGGCGTGTGAAGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143883.1-548s21c1
Sequence:CCGGGAGAAAGGATTTCGTTATAAGCTCGAGCTTATAACGAAATCCTTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143883.2-147s21c1
Sequence:CCGGGTTTGCAGACAAGATTCTAAACTCGAGTTTAGAATCTTGTCTGCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337229    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143883.1-892s21c1
Sequence:CCGGCATTGCTGACTGTGGACAATTCTCGAGAATTGTCCACAGTCAGCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143883.2-504s21c1
Sequence:CCGGGCACTTTGGGTACAGGAATAGCTCGAGCTATTCCTGTACCCAAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001143883
PPIAL4B MISSION shRNA shRNA Plasmid DNA
peptidylprolyl isomerase A (cyclophilin A)-like 4B
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000377627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143883.2-361s21c1
Sequence:CCGGGGCATCTTGTCCATGGCAAATCTCGAGATTTGCCATGGACAAGATGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143883.2-469s21c1
Sequence:CCGGGTGAAAGAACGTGTGAATATTCTCGAGAATATTCACACGTTCTTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143883.1-584s21c1
Sequence:CCGGAGAATTATTCCAGGGTTTATGCTCGAGCATAAACCCTGGAATAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143883.1-615s21c1
Sequence:CCGGGTGACTTCACACGCCATAATGCTCGAGCATTATGGCGTGTGAAGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143883.1-548s21c1
Sequence:CCGGGAGAAAGGATTTCGTTATAAGCTCGAGCTTATAACGAAATCCTTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143883.2-147s21c1
Sequence:CCGGGTTTGCAGACAAGATTCTAAACTCGAGTTTAGAATCTTGTCTGCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337229    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143883.1-892s21c1
Sequence:CCGGCATTGCTGACTGTGGACAATTCTCGAGAATTGTCCACAGTCAGCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143883.2-504s21c1
Sequence:CCGGGCACTTTGGGTACAGGAATAGCTCGAGCTATTCCTGTACCCAAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001143883
PPIAL4B MISSION shRNA Lentiviral Transduction Particles
peptidylprolyl isomerase A (cyclophilin A)-like 4B
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000377627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143883.2-361s21c1
Sequence:CCGGGGCATCTTGTCCATGGCAAATCTCGAGATTTGCCATGGACAAGATGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143883.2-469s21c1
Sequence:CCGGGTGAAAGAACGTGTGAATATTCTCGAGAATATTCACACGTTCTTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143883.1-584s21c1
Sequence:CCGGAGAATTATTCCAGGGTTTATGCTCGAGCATAAACCCTGGAATAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143883.1-615s21c1
Sequence:CCGGGTGACTTCACACGCCATAATGCTCGAGCATTATGGCGTGTGAAGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143883.1-548s21c1
Sequence:CCGGGAGAAAGGATTTCGTTATAAGCTCGAGCTTATAACGAAATCCTTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143883.2-147s21c1
Sequence:CCGGGTTTGCAGACAAGATTCTAAACTCGAGTTTAGAATCTTGTCTGCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337229    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143883.1-892s21c1
Sequence:CCGGCATTGCTGACTGTGGACAATTCTCGAGAATTGTCCACAGTCAGCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143883.2-504s21c1
Sequence:CCGGGCACTTTGGGTACAGGAATAGCTCGAGCTATTCCTGTACCCAAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks