EMAIL THIS PAGE TO A FRIEND

PPIL3

peptidylprolyl isomerase (cyclophilin)-like 3

Synonyms: CYPJ
UniProtKB ID: Q9H2H8, Q86WF9, Q96IA9, Q9BXZ1
Gene ID:
Human(53938) Summary: This gene encodes a member of the cyclophilin family. Cyclophilins catalyze the cis-trans isomerization of peptidylprolyl imide bonds in oligopeptides. They have been proposed to act either as catalysts or as molecular chaperones in protein-folding events. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2008]
Mouse(70225) peptidylprolyl isomerase (cyclophilin)-like 3
Rat(301432) peptidylprolyl isomerase (cyclophilin)-like 3
cow(615703) peptidylprolyl isomerase (cyclophilin)-like 3
sheep(100302351) peptidylprolyl isomerase (cyclophilin)-like 3
Goat(100861150) peptidylprolyl isomerase (cyclophilin)-like 3
domestic guinea pig(100719386) peptidylprolyl isomerase (cyclophilin)-like 3
naked mole-rat(101717884) peptidylprolyl isomerase (cyclophilin)-like 3
chicken(424075) peptidylprolyl isomerase (cyclophilin)-like 3
domestic cat(101092630) peptidylprolyl isomerase (cyclophilin)-like 3
dog(607430) peptidylprolyl isomerase (cyclophilin)-like 3
106 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_130906 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_130906 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_130906 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027351 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027351 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027351 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032472 Rosetta Predictions human pricing
NM_130906 Rosetta Predictions human pricing
NM_131916 Rosetta Predictions human pricing
NM_175707 Rosetta Predictions rat pricing
NM_027351 Rosetta Predictions mouse pricing
NM_027374 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032472 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00155840 predicted 740
2 SASI_Hs01_00155841 predicted 686
3 SASI_Hs01_00155842 predicted 724
4 SASI_Hs01_00155843 predicted 712
5 SASI_Hs01_00155844 predicted 670
6 SASI_Hs01_00155845 predicted 819
7 SASI_Hs01_00155846 predicted 672
8 SASI_Hs01_00155847 predicted 702
9 SASI_Hs01_00155848 predicted 766
10 SASI_Hs01_00155849 predicted 688
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130906 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00031119 predicted 666
2 SASI_Hs01_00031120 predicted 612
3 SASI_Hs01_00031121 predicted 641
4 SASI_Hs01_00031122 predicted 641
5 SASI_Hs01_00031123 predicted 599
6 SASI_Hs01_00031124 predicted 746
7 SASI_Hs01_00031125 predicted 592
8 SASI_Hs01_00031126 predicted 623
9 SASI_Hs01_00031127 predicted 686
10 SASI_Hs01_00031128 predicted 618
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_131916 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00149324 predicted 1166
2 SASI_Hs01_00149325 predicted 1114
3 SASI_Hs01_00149326 predicted 1146
4 SASI_Hs01_00149327 predicted 1146
5 SASI_Hs01_00149328 predicted 1108
6 SASI_Hs01_00149329 predicted 1243
7 SASI_Hs01_00149330 predicted 1100
8 SASI_Hs01_00149331 predicted 1125
9 SASI_Hs01_00149332 predicted 1191
10 SASI_Hs01_00149333 predicted 1122
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175707 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00084540 predicted 755
2 SASI_Rn01_00084541 predicted 693
3 SASI_Rn01_00084542 predicted 527
4 SASI_Rn02_00269503 predicted 567
5 SASI_Rn01_00084544 predicted 511
6 SASI_Rn02_00269504 predicted 456
7 SASI_Rn01_00084545 predicted 331
8 SASI_Rn01_00084547 predicted 472
9 SASI_Rn01_00084549 predicted 762
10 SASI_Rn02_00269505 predicted 548
11 SASI_Rn01_00084543 predicted 364
12 SASI_Rn01_00084546 predicted 750
13 SASI_Rn01_00084548 predicted 749
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027351 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00169289 predicted 638
2 SASI_Mm01_00169290 predicted 453
3 SASI_Mm01_00169291 predicted 241
4 SASI_Mm01_00169292 predicted 498
5 SASI_Mm01_00169293 predicted 285
6 SASI_Mm01_00169294 predicted 621
7 SASI_Mm01_00169296 predicted 528
8 SASI_Mm01_00169297 predicted 549
9 SASI_Mm02_00332018 predicted 275
10 SASI_Mm01_00169298 predicted 219
11 SASI_Mm01_00169295 predicted 353
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027374 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00332064 predicted 387
2 SASI_Mm01_00088967 predicted 476
3 SASI_Mm01_00088970 predicted 503
4 SASI_Mm02_00332065 predicted 408
5 SASI_Mm01_00088971 predicted 589
6 SASI_Mm01_00088972 predicted 462
7 SASI_Mm02_00332066 predicted 413
8 SASI_Mm02_00332067 predicted 598
9 SASI_Mm01_00088974 predicted 457
10 SASI_Mm02_00332068 predicted 647
11 SASI_Mm01_00088965 predicted 413
12 SASI_Mm01_00088966 predicted 200
13 SASI_Mm01_00088968 predicted 426
14 SASI_Mm01_00088969 predicted 378
15 SASI_Mm01_00088973 predicted 439
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_130906
VALIDATED
PPIL3 MISSION shRNA Bacterial Glycerol Stock
peptidylprolyl isomerase (cyclophilin)-like 3
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000231437    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130906.1-281s21c1
Sequence:CCGGTTACTACAATGGCTGTATATTCTCGAGAATATACAGCCATTGTAGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130906.1-432s21c1
Sequence:CCGGGTTGTATCTATGGCTAATAATCTCGAGATTATTAGCCATAGATACAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130906.1-618s21c1
Sequence:CCGGCACATTAAGGACATAACTATTCTCGAGAATAGTTATGTCCTTAATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231441    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_130906.1-665s21c1
Sequence:CCGGATGATAGACCTGGACAAATAACTCGAGTTATTTGTCCAGGTCTATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130906.1-522s21c1
Sequence:CCGGACCGTATTTGGAAAGGTAATACTCGAGTATTACCTTTCCAAATACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000184    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_130906.x-748s1c1
Sequence:CCGGCATCATCCTTCTGCTTGTTTACTCGAGTAAACAAGCAGAAGGATGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_130906.x-471s1c1
Sequence:CCGGTCTCAGTTCTTCATCACCTATCTCGAGATAGGTGATGAAGAACTGAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000188    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_130906.x-599s1c1
Sequence:CCGGCCGACCTCTTAATGATGTACACTCGAGTGTACATCATTAAGAGGTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130906.x-428s1c1
Sequence:CCGGAGGTGTTGTATCTATGGCTAACTCGAGTTAGCCATAGATACAACACCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_130906
VALIDATED
PPIL3 MISSION shRNA shRNA Plasmid DNA
peptidylprolyl isomerase (cyclophilin)-like 3
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000231437    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130906.1-281s21c1
Sequence:CCGGTTACTACAATGGCTGTATATTCTCGAGAATATACAGCCATTGTAGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130906.1-432s21c1
Sequence:CCGGGTTGTATCTATGGCTAATAATCTCGAGATTATTAGCCATAGATACAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130906.1-618s21c1
Sequence:CCGGCACATTAAGGACATAACTATTCTCGAGAATAGTTATGTCCTTAATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231441    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_130906.1-665s21c1
Sequence:CCGGATGATAGACCTGGACAAATAACTCGAGTTATTTGTCCAGGTCTATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130906.1-522s21c1
Sequence:CCGGACCGTATTTGGAAAGGTAATACTCGAGTATTACCTTTCCAAATACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000184    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_130906.x-748s1c1
Sequence:CCGGCATCATCCTTCTGCTTGTTTACTCGAGTAAACAAGCAGAAGGATGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_130906.x-471s1c1
Sequence:CCGGTCTCAGTTCTTCATCACCTATCTCGAGATAGGTGATGAAGAACTGAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000188    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_130906.x-599s1c1
Sequence:CCGGCCGACCTCTTAATGATGTACACTCGAGTGTACATCATTAAGAGGTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130906.x-428s1c1
Sequence:CCGGAGGTGTTGTATCTATGGCTAACTCGAGTTAGCCATAGATACAACACCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_130906
VALIDATED
PPIL3 MISSION shRNA Lentiviral Transduction Particles
peptidylprolyl isomerase (cyclophilin)-like 3
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000231437    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130906.1-281s21c1
Sequence:CCGGTTACTACAATGGCTGTATATTCTCGAGAATATACAGCCATTGTAGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130906.1-432s21c1
Sequence:CCGGGTTGTATCTATGGCTAATAATCTCGAGATTATTAGCCATAGATACAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130906.1-618s21c1
Sequence:CCGGCACATTAAGGACATAACTATTCTCGAGAATAGTTATGTCCTTAATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231441    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_130906.1-665s21c1
Sequence:CCGGATGATAGACCTGGACAAATAACTCGAGTTATTTGTCCAGGTCTATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130906.1-522s21c1
Sequence:CCGGACCGTATTTGGAAAGGTAATACTCGAGTATTACCTTTCCAAATACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000184    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_130906.x-748s1c1
Sequence:CCGGCATCATCCTTCTGCTTGTTTACTCGAGTAAACAAGCAGAAGGATGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_130906.x-471s1c1
Sequence:CCGGTCTCAGTTCTTCATCACCTATCTCGAGATAGGTGATGAAGAACTGAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000188    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_130906.x-599s1c1
Sequence:CCGGCCGACCTCTTAATGATGTACACTCGAGTGTACATCATTAAGAGGTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130906.x-428s1c1
Sequence:CCGGAGGTGTTGTATCTATGGCTAACTCGAGTTAGCCATAGATACAACACCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027351
VALIDATED
PPIL3 MISSION shRNA Bacterial Glycerol Stock
peptidylprolyl isomerase (cyclophilin)-like 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000101280    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027351.1-704s1c1
Sequence:CCGGCCTGGACAGATACTTGGTGAACTCGAGTTCACCAAGTATCTGTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027351.1-321s1c1
Sequence:CCGGCGGCTGTGTGTTTCATAGAAACTCGAGTTTCTATGAAACACACAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101282    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027351.1-532s1c1
Sequence:CCGGCCACACTTGGACATGAAATATCTCGAGATATTTCATGTCCAAGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027351.1-531s1c1
Sequence:CCGGGCCACACTTGGACATGAAATACTCGAGTATTTCATGTCCAAGTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101284    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027351.1-634s1c1
Sequence:CCGGCCTCTTAATGATGTACACATTCTCGAGAATGTGTACATCATTAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027351
VALIDATED
PPIL3 MISSION shRNA shRNA Plasmid DNA
peptidylprolyl isomerase (cyclophilin)-like 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000101280    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027351.1-704s1c1
Sequence:CCGGCCTGGACAGATACTTGGTGAACTCGAGTTCACCAAGTATCTGTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027351.1-321s1c1
Sequence:CCGGCGGCTGTGTGTTTCATAGAAACTCGAGTTTCTATGAAACACACAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101282    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027351.1-532s1c1
Sequence:CCGGCCACACTTGGACATGAAATATCTCGAGATATTTCATGTCCAAGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027351.1-531s1c1
Sequence:CCGGGCCACACTTGGACATGAAATACTCGAGTATTTCATGTCCAAGTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101284    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027351.1-634s1c1
Sequence:CCGGCCTCTTAATGATGTACACATTCTCGAGAATGTGTACATCATTAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027351
VALIDATED
PPIL3 MISSION shRNA Lentiviral Transduction Particles
peptidylprolyl isomerase (cyclophilin)-like 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000101280    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027351.1-704s1c1
Sequence:CCGGCCTGGACAGATACTTGGTGAACTCGAGTTCACCAAGTATCTGTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027351.1-321s1c1
Sequence:CCGGCGGCTGTGTGTTTCATAGAAACTCGAGTTTCTATGAAACACACAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101282    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027351.1-532s1c1
Sequence:CCGGCCACACTTGGACATGAAATATCTCGAGATATTTCATGTCCAAGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027351.1-531s1c1
Sequence:CCGGGCCACACTTGGACATGAAATACTCGAGTATTTCATGTCCAAGTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101284    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027351.1-634s1c1
Sequence:CCGGCCTCTTAATGATGTACACATTCTCGAGAATGTGTACATCATTAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks