EMAIL THIS PAGE TO A FRIEND

PPIP5K2

diphosphoinositol pentakisphosphate kinase 2

Synonyms: HISPPD1 IP7K2 VIP2
UniProtKB ID: O43314, A1NI53, A6NGS8, Q8TB50
Gene ID:
Human(23262) Summary: Inositol phosphates (IPs) and diphosphoinositol phosphates (PP-IPs), also known as inositol pyrophosphates, act as cell signaling molecules. HISPPD1 has both IP6 kinase (EC 2.7.4.21) and PP-IP5 (also called IP7) kinase (EC 2.7.4.24) activities that produce the high-energy pyrophosphates PP-IP5 and PP2-IP4 (also called IP8), respectively (Fridy et al., 2007 [PubMed 17690096]
Mouse(227399) diphosphoinositol pentakisphosphate kinase 2
Rat(501194) diphosphoinositol pentakisphosphate kinase 2
Zebrafish(449862) diphosphoinositol pentakisphosphate kinase 2
chicken(427276) diphosphoinositol pentakisphosphate kinase 2
domestic cat(101091503) diphosphoinositol pentakisphosphate kinase 2
Horse(100064726) diphosphoinositol pentakisphosphate kinase 2
dog(488883) diphosphoinositol pentakisphosphate kinase 2
cow(780855) diphosphoinositol pentakisphosphate kinase 2
sheep(101114441) diphosphoinositol pentakisphosphate kinase 2
domestic guinea pig(100712709) diphosphoinositol pentakisphosphate kinase 2
Domestic Rabbit(100353531) diphosphoinositol pentakisphosphate kinase 2
naked mole-rat(101719804) diphosphoinositol pentakisphosphate kinase 2
151 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015216 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015216 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015216 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_173760 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_173760 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_173760 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015216 Rosetta Predictions human pricing
NM_001025775 Rosetta Predictions rat pricing
NM_173760 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015216 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00197670 predicted 2142
2 SASI_Hs01_00197671 predicted 2130
3 SASI_Hs01_00197672 predicted 2888
4 SASI_Hs01_00197673 predicted 2970
5 SASI_Hs02_00347327 predicted 1967
6 SASI_Hs01_00197674 predicted 1151
7 SASI_Hs01_00197675 predicted 1143
8 SASI_Hs01_00197676 predicted 1063
9 SASI_Hs01_00197678 predicted 2619
10 SASI_Hs01_00197679 predicted 1465
11 SASI_Hs01_00197677 predicted 1176
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025775 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00038549 predicted 579
2 SASI_Rn01_00038550 predicted 1286
3 SASI_Rn02_00203455 predicted 497
4 SASI_Rn01_00038551 predicted 566
5 SASI_Rn01_00038553 predicted 655
6 SASI_Rn01_00038554 predicted 849
7 SASI_Rn01_00038555 predicted 1280
8 SASI_Rn01_00038556 predicted 558
9 SASI_Rn01_00038557 predicted 973
10 SASI_Rn01_00038558 predicted 761
11 SASI_Rn01_00038552 predicted 1179
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173760 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00345410 predicted 920
2 SASI_Mm01_00131561 predicted 2511
3 SASI_Mm01_00131562 predicted 1623
4 SASI_Mm01_00131563 predicted 2720
5 SASI_Mm01_00131564 predicted 2929
6 SASI_Mm01_00131565 predicted 2851
7 SASI_Mm02_00345411 predicted 2662
8 SASI_Mm01_00131566 predicted 2309
9 SASI_Mm01_00131567 predicted 3989
10 SASI_Mm02_00345412 predicted 2680
11 SASI_Mm01_00131559 predicted 2090
12 SASI_Mm01_00131560 predicted 1958
13 SASI_Mm01_00131568 predicted 1718
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015216
VALIDATED
PPIP5K2 MISSION shRNA Bacterial Glycerol Stock
diphosphoinositol pentakisphosphate kinase 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000376569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015216.2-3445s21c1
Sequence:CCGGTCCACGGAAGACCGCTGAAATCTCGAGATTTCAGCGGTCTTCCGTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376570    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015216.2-2587s21c1
Sequence:CCGGGAAACGAGCTATGGATTATTTCTCGAGAAATAATCCATAGCTCGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015216.2-3261s21c1
Sequence:CCGGCACCTAACCTACAGGATTATGCTCGAGCATAATCCTGTAGGTTAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015216.2-1079s1c1
Sequence:CCGGCGAGAACTTGCTCCACAATTTCTCGAGAAATTGTGGAGCAAGTTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134115    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015216.2-4624s1c1
Sequence:CCGGCCATTCTTATCCCTAGTGTATCTCGAGATACACTAGGGATAAGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133872    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015216.2-4618s1c1
Sequence:CCGGCCATTTCCATTCTTATCCCTACTCGAGTAGGGATAAGAATGGAAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134756    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015216.2-3557s1c1
Sequence:CCGGGCTACCTTAAAGAGCACTAAACTCGAGTTTAGTGCTCTTTAAGGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015216.2-3086s1c1
Sequence:CCGGCCCAAATCATTGGCTTTCACACTCGAGTGTGAAAGCCAATGATTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015216
VALIDATED
PPIP5K2 MISSION shRNA shRNA Plasmid DNA
diphosphoinositol pentakisphosphate kinase 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000376569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015216.2-3445s21c1
Sequence:CCGGTCCACGGAAGACCGCTGAAATCTCGAGATTTCAGCGGTCTTCCGTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376570    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015216.2-2587s21c1
Sequence:CCGGGAAACGAGCTATGGATTATTTCTCGAGAAATAATCCATAGCTCGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015216.2-3261s21c1
Sequence:CCGGCACCTAACCTACAGGATTATGCTCGAGCATAATCCTGTAGGTTAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015216.2-1079s1c1
Sequence:CCGGCGAGAACTTGCTCCACAATTTCTCGAGAAATTGTGGAGCAAGTTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134115    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015216.2-4624s1c1
Sequence:CCGGCCATTCTTATCCCTAGTGTATCTCGAGATACACTAGGGATAAGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133872    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015216.2-4618s1c1
Sequence:CCGGCCATTTCCATTCTTATCCCTACTCGAGTAGGGATAAGAATGGAAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134756    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015216.2-3557s1c1
Sequence:CCGGGCTACCTTAAAGAGCACTAAACTCGAGTTTAGTGCTCTTTAAGGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015216.2-3086s1c1
Sequence:CCGGCCCAAATCATTGGCTTTCACACTCGAGTGTGAAAGCCAATGATTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015216
VALIDATED
PPIP5K2 MISSION shRNA Lentiviral Transduction Particles
diphosphoinositol pentakisphosphate kinase 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000376569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015216.2-3445s21c1
Sequence:CCGGTCCACGGAAGACCGCTGAAATCTCGAGATTTCAGCGGTCTTCCGTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376570    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015216.2-2587s21c1
Sequence:CCGGGAAACGAGCTATGGATTATTTCTCGAGAAATAATCCATAGCTCGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015216.2-3261s21c1
Sequence:CCGGCACCTAACCTACAGGATTATGCTCGAGCATAATCCTGTAGGTTAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015216.2-1079s1c1
Sequence:CCGGCGAGAACTTGCTCCACAATTTCTCGAGAAATTGTGGAGCAAGTTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134115    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015216.2-4624s1c1
Sequence:CCGGCCATTCTTATCCCTAGTGTATCTCGAGATACACTAGGGATAAGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133872    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015216.2-4618s1c1
Sequence:CCGGCCATTTCCATTCTTATCCCTACTCGAGTAGGGATAAGAATGGAAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134756    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015216.2-3557s1c1
Sequence:CCGGGCTACCTTAAAGAGCACTAAACTCGAGTTTAGTGCTCTTTAAGGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015216.2-3086s1c1
Sequence:CCGGCCCAAATCATTGGCTTTCACACTCGAGTGTGAAAGCCAATGATTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173760
VALIDATED
PPIP5K2 MISSION shRNA Bacterial Glycerol Stock
diphosphoinositol pentakisphosphate kinase 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000217308    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173760.4-3070s1c1
Sequence:CCGGGGAAACGAGCTATGGATTATCCTCGAGGATAATCCATAGCTCGTTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241777    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173760.4-3822s21c1
Sequence:CCGGTCTCGGAAGAAGAGCATAAATCTCGAGATTTATGCTCTTCTTCCGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241781    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173760.4-4390s21c1
Sequence:CCGGGTCATTGCTACAGTAACATATCTCGAGATATGTTACTGTAGCAATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241780    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173760.4-2967s21c1
Sequence:CCGGCACGTCCGCACCAGATTATATCTCGAGATATAATCTGGTGCGGACGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173760.4-3026s21c1
Sequence:CCGGTCTTCGGTATGGCGCCTTATGCTCGAGCATAAGGCGCCATACCGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241778    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173760.4-1945s21c1
Sequence:CCGGTAAACCGTAAGGTCCAATTAACTCGAGTTAATTGGACCTTACGGTTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193063    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173760.3-3409s1c1
Sequence:CCGGCCGAAAGTTTCCATGCTTATACTCGAGTATAAGCATGGAAACTTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192355    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173760.3-4309s1c1
Sequence:CCGGCCATTCTTATGTCCAGTGTATCTCGAGATACACTGGACATAAGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191288    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173760.3-2883s1c1
Sequence:CCGGCCAATTCATATACACAGGAAACTCGAGTTTCCTGTGTATATGAATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173760
VALIDATED
PPIP5K2 MISSION shRNA shRNA Plasmid DNA
diphosphoinositol pentakisphosphate kinase 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000217308    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173760.4-3070s1c1
Sequence:CCGGGGAAACGAGCTATGGATTATCCTCGAGGATAATCCATAGCTCGTTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241777    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173760.4-3822s21c1
Sequence:CCGGTCTCGGAAGAAGAGCATAAATCTCGAGATTTATGCTCTTCTTCCGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241781    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173760.4-4390s21c1
Sequence:CCGGGTCATTGCTACAGTAACATATCTCGAGATATGTTACTGTAGCAATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241780    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173760.4-2967s21c1
Sequence:CCGGCACGTCCGCACCAGATTATATCTCGAGATATAATCTGGTGCGGACGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173760.4-3026s21c1
Sequence:CCGGTCTTCGGTATGGCGCCTTATGCTCGAGCATAAGGCGCCATACCGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241778    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173760.4-1945s21c1
Sequence:CCGGTAAACCGTAAGGTCCAATTAACTCGAGTTAATTGGACCTTACGGTTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193063    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173760.3-3409s1c1
Sequence:CCGGCCGAAAGTTTCCATGCTTATACTCGAGTATAAGCATGGAAACTTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192355    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173760.3-4309s1c1
Sequence:CCGGCCATTCTTATGTCCAGTGTATCTCGAGATACACTGGACATAAGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191288    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173760.3-2883s1c1
Sequence:CCGGCCAATTCATATACACAGGAAACTCGAGTTTCCTGTGTATATGAATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173760
VALIDATED
PPIP5K2 MISSION shRNA Lentiviral Transduction Particles
diphosphoinositol pentakisphosphate kinase 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000217308    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173760.4-3070s1c1
Sequence:CCGGGGAAACGAGCTATGGATTATCCTCGAGGATAATCCATAGCTCGTTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241777    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173760.4-3822s21c1
Sequence:CCGGTCTCGGAAGAAGAGCATAAATCTCGAGATTTATGCTCTTCTTCCGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241781    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173760.4-4390s21c1
Sequence:CCGGGTCATTGCTACAGTAACATATCTCGAGATATGTTACTGTAGCAATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241780    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173760.4-2967s21c1
Sequence:CCGGCACGTCCGCACCAGATTATATCTCGAGATATAATCTGGTGCGGACGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173760.4-3026s21c1
Sequence:CCGGTCTTCGGTATGGCGCCTTATGCTCGAGCATAAGGCGCCATACCGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241778    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173760.4-1945s21c1
Sequence:CCGGTAAACCGTAAGGTCCAATTAACTCGAGTTAATTGGACCTTACGGTTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193063    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173760.3-3409s1c1
Sequence:CCGGCCGAAAGTTTCCATGCTTATACTCGAGTATAAGCATGGAAACTTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192355    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173760.3-4309s1c1
Sequence:CCGGCCATTCTTATGTCCAGTGTATCTCGAGATACACTGGACATAAGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191288    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173760.3-2883s1c1
Sequence:CCGGCCAATTCATATACACAGGAAACTCGAGTTTCCTGTGTATATGAATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks