EMAIL THIS PAGE TO A FRIEND

PPL

periplakin

UniProtKB ID: O60437, O60314, O60454, Q14C98
Gene ID:
Human(5493) Summary: The protein encoded by this gene is a component of desmosomes and of the epidermal cornified envelope in keratinocytes. The N-terminal domain of this protein interacts with the plasma membrane and its C-terminus interacts with intermediate filaments. Through its rod domain, this protein forms complexes with envoplakin. This protein may serve as a link between the cornified envelope and desmosomes as well as intermediate filaments. AKT1/PKB, a protein kinase mediating a variety of cell growth and survival signaling processes, is reported to interact with this protein, suggesting a possible role for this protein as a localization signal in AKT1-mediated signaling. [provided by RefSeq, Jul 2008]
Mouse(19041) periplakin
Rat(302934) periplakin
fruit fly(40349) pumpless
Zebrafish(449936) periplakin
chicken(408044) periplakin
Horse(100069951) periplakin
dog(490021) periplakin
cow(522886) periplakin
sheep(101104034) periplakin
Gene Class: Cytoskeleton
55 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002705 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002705 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002705 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008909 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008909 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008909 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU053981 MISSION® esiRNA esiRNA human PPL (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002705 Rosetta Predictions human pricing
NM_001106976 Rosetta Predictions rat pricing
NM_008909 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002705 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00025164 predicted 2618
2 SASI_Hs01_00025165 predicted 3772
3 SASI_Hs01_00025167 predicted 4878
4 SASI_Hs01_00025168 predicted 2840
5 SASI_Hs02_00334287 predicted 1412
6 SASI_Hs01_00025170 predicted 5284
7 SASI_Hs01_00025171 predicted 322
8 SASI_Hs01_00025172 predicted 584
9 SASI_Hs01_00025173 predicted 883
10 SASI_Hs02_00334288 predicted 5203
11 SASI_Hs01_00025166 predicted 2483
12 SASI_Hs01_00025169 predicted 1420
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106976 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00224266 predicted 3756
2 SASI_Rn02_00224267 predicted 4687
3 SASI_Rn02_00224268 predicted 1842
4 SASI_Rn02_00224269 predicted 3859
5 SASI_Rn02_00224270 predicted 2267
6 SASI_Rn02_00224271 predicted 4157
7 SASI_Rn02_00224272 predicted 2273
8 SASI_Rn02_00224273 predicted 5262
9 SASI_Rn02_00224274 predicted 2645
10 SASI_Rn02_00224275 predicted 3998
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008909 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00196279 predicted 4750
2 SASI_Mm01_00196280 predicted 2032
3 SASI_Mm01_00196282 predicted 1703
4 SASI_Mm02_00314929 predicted 1628
5 SASI_Mm01_00196283 predicted 2044
6 SASI_Mm01_00196285 predicted 4064
7 SASI_Mm01_00196286 predicted 711
8 SASI_Mm01_00196288 predicted 2709
9 SASI_Mm02_00314930 predicted 4944
10 SASI_Mm02_00314931 predicted 3464
11 SASI_Mm01_00196281 predicted 5226
12 SASI_Mm01_00196284 predicted 5417
13 SASI_Mm01_00196287 predicted 5276
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002705
PPL MISSION shRNA Bacterial Glycerol Stock
periplakin
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000116940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002705.3-2617s1c1
Sequence:CCGGGCCGCCAAGTTCACTGAAGTTCTCGAGAACTTCAGTGAACTTGGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002705.3-5298s1c1
Sequence:CCGGCCGCTATGTCAACAAGGATATCTCGAGATATCCTTGTTGACATAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002705.3-3778s1c1
Sequence:CCGGGAGGTGACTAAGGAAGTCATTCTCGAGAATGACTTCCTTAGTCACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116937    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002705.3-5977s1c1
Sequence:CCGGCGGCACCTACAGAGAATGTTTCTCGAGAAACATTCTCTGTAGGTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002705.3-2619s1c1
Sequence:CCGGCGCCAAGTTCACTGAAGTTTACTCGAGTAAACTTCAGTGAACTTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002705.4-1860s21c1
Sequence:CCGGGGAGGACACCAACCGGAAATACTCGAGTATTTCCGGTTGGTGTCCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002705.4-2466s21c1
Sequence:CCGGGCAGTACCAGCAAGCTGTAAACTCGAGTTTACAGCTTGCTGGTACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002705
PPL MISSION shRNA shRNA Plasmid DNA
periplakin
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000116940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002705.3-2617s1c1
Sequence:CCGGGCCGCCAAGTTCACTGAAGTTCTCGAGAACTTCAGTGAACTTGGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002705.3-5298s1c1
Sequence:CCGGCCGCTATGTCAACAAGGATATCTCGAGATATCCTTGTTGACATAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002705.3-3778s1c1
Sequence:CCGGGAGGTGACTAAGGAAGTCATTCTCGAGAATGACTTCCTTAGTCACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116937    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002705.3-5977s1c1
Sequence:CCGGCGGCACCTACAGAGAATGTTTCTCGAGAAACATTCTCTGTAGGTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002705.3-2619s1c1
Sequence:CCGGCGCCAAGTTCACTGAAGTTTACTCGAGTAAACTTCAGTGAACTTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002705.4-1860s21c1
Sequence:CCGGGGAGGACACCAACCGGAAATACTCGAGTATTTCCGGTTGGTGTCCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002705.4-2466s21c1
Sequence:CCGGGCAGTACCAGCAAGCTGTAAACTCGAGTTTACAGCTTGCTGGTACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002705
PPL MISSION shRNA Lentiviral Transduction Particles
periplakin
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000116940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002705.3-2617s1c1
Sequence:CCGGGCCGCCAAGTTCACTGAAGTTCTCGAGAACTTCAGTGAACTTGGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002705.3-5298s1c1
Sequence:CCGGCCGCTATGTCAACAAGGATATCTCGAGATATCCTTGTTGACATAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002705.3-3778s1c1
Sequence:CCGGGAGGTGACTAAGGAAGTCATTCTCGAGAATGACTTCCTTAGTCACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116937    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002705.3-5977s1c1
Sequence:CCGGCGGCACCTACAGAGAATGTTTCTCGAGAAACATTCTCTGTAGGTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002705.3-2619s1c1
Sequence:CCGGCGCCAAGTTCACTGAAGTTTACTCGAGTAAACTTCAGTGAACTTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002705.4-1860s21c1
Sequence:CCGGGGAGGACACCAACCGGAAATACTCGAGTATTTCCGGTTGGTGTCCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002705.4-2466s21c1
Sequence:CCGGGCAGTACCAGCAAGCTGTAAACTCGAGTTTACAGCTTGCTGGTACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008909
VALIDATED
PPL MISSION shRNA Bacterial Glycerol Stock
periplakin
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000090573    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008909.1-5589s1c1
Sequence:CCGGCCACCTCTGATGACTTAATAACTCGAGTTATTAAGTCATCAGAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090574    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008909.1-5269s1c1
Sequence:CCGGGCTGCTCAATATGACCGCTATCTCGAGATAGCGGTCATATTGAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090576    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008909.1-4700s1c1
Sequence:CCGGCCAAGTTATCTGAGCTAGAATCTCGAGATTCTAGCTCAGATAACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008909.1-2461s1c1
Sequence:CCGGGCGGTGAAGGACTATGAACTTCTCGAGAAGTTCATAGTCCTTCACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090575    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008909.1-4213s1c1
Sequence:CCGGCGGCAGATTGATAAACTGCATCTCGAGATGCAGTTTATCAATCTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008909.2-4270s21c1
Sequence:CCGGCGGCAGATTGATAAACTGCATCTCGAGATGCAGTTTATCAATCTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305396    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008909.2-3899s21c1
Sequence:CCGGTGGACAAGACCAGGTTAATAGCTCGAGCTATTAACCTGGTCTTGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008909.2-2663s21c1
Sequence:CCGGCCAAGTTCACAGAGGTTAATGCTCGAGCATTAACCTCTGTGAACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309466    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008909.2-4757s21c1
Sequence:CCGGCCAAGTTATCTGAGCTAGAATCTCGAGATTCTAGCTCAGATAACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309538    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008909.2-5646s21c1
Sequence:CCGGCCACCTCTGATGACTTAATAACTCGAGTTATTAAGTCATCAGAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008909
VALIDATED
PPL MISSION shRNA shRNA Plasmid DNA
periplakin
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000090573    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008909.1-5589s1c1
Sequence:CCGGCCACCTCTGATGACTTAATAACTCGAGTTATTAAGTCATCAGAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090574    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008909.1-5269s1c1
Sequence:CCGGGCTGCTCAATATGACCGCTATCTCGAGATAGCGGTCATATTGAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090576    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008909.1-4700s1c1
Sequence:CCGGCCAAGTTATCTGAGCTAGAATCTCGAGATTCTAGCTCAGATAACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008909.1-2461s1c1
Sequence:CCGGGCGGTGAAGGACTATGAACTTCTCGAGAAGTTCATAGTCCTTCACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090575    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008909.1-4213s1c1
Sequence:CCGGCGGCAGATTGATAAACTGCATCTCGAGATGCAGTTTATCAATCTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008909.2-4270s21c1
Sequence:CCGGCGGCAGATTGATAAACTGCATCTCGAGATGCAGTTTATCAATCTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305396    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008909.2-3899s21c1
Sequence:CCGGTGGACAAGACCAGGTTAATAGCTCGAGCTATTAACCTGGTCTTGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008909.2-2663s21c1
Sequence:CCGGCCAAGTTCACAGAGGTTAATGCTCGAGCATTAACCTCTGTGAACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309466    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008909.2-4757s21c1
Sequence:CCGGCCAAGTTATCTGAGCTAGAATCTCGAGATTCTAGCTCAGATAACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309538    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008909.2-5646s21c1
Sequence:CCGGCCACCTCTGATGACTTAATAACTCGAGTTATTAAGTCATCAGAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008909
VALIDATED
PPL MISSION shRNA Lentiviral Transduction Particles
periplakin
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000090573    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008909.1-5589s1c1
Sequence:CCGGCCACCTCTGATGACTTAATAACTCGAGTTATTAAGTCATCAGAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090574    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008909.1-5269s1c1
Sequence:CCGGGCTGCTCAATATGACCGCTATCTCGAGATAGCGGTCATATTGAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090576    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008909.1-4700s1c1
Sequence:CCGGCCAAGTTATCTGAGCTAGAATCTCGAGATTCTAGCTCAGATAACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008909.1-2461s1c1
Sequence:CCGGGCGGTGAAGGACTATGAACTTCTCGAGAAGTTCATAGTCCTTCACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090575    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008909.1-4213s1c1
Sequence:CCGGCGGCAGATTGATAAACTGCATCTCGAGATGCAGTTTATCAATCTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008909.2-4270s21c1
Sequence:CCGGCGGCAGATTGATAAACTGCATCTCGAGATGCAGTTTATCAATCTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305396    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008909.2-3899s21c1
Sequence:CCGGTGGACAAGACCAGGTTAATAGCTCGAGCTATTAACCTGGTCTTGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008909.2-2663s21c1
Sequence:CCGGCCAAGTTCACAGAGGTTAATGCTCGAGCATTAACCTCTGTGAACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309466    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008909.2-4757s21c1
Sequence:CCGGCCAAGTTATCTGAGCTAGAATCTCGAGATTCTAGCTCAGATAACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309538    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008909.2-5646s21c1
Sequence:CCGGCCACCTCTGATGACTTAATAACTCGAGTTATTAAGTCATCAGAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks