EMAIL THIS PAGE TO A FRIEND

PPM1G

protein phosphatase, Mg2+/Mn2+ dependent, 1G

Synonyms: PP2CG PP2CGAMMA PPP2CG
UniProtKB ID: O15355
Gene ID:
Human(5496) Summary: The protein encoded by this gene is a member of the PP2C family of Ser/Thr protein phosphatases. PP2C family members are known to be negative regulators of cell stress response pathways. This phosphatase is found to be responsible for the dephosphorylation of Pre-mRNA splicing factors, which is important for the formation of functional spliceosome. Studies of a similar gene in mice suggested a role of this phosphatase in regulating cell cycle progression. [provided by RefSeq, Apr 2010]
Mouse(14208) protein phosphatase 1G (formerly 2C), magnesium-dependent, gamma isoform
Rat(259229) protein phosphatase, Mg2+/Mn2+ dependent, 1G
Zebrafish(368275) protein phosphatase 1G (formerly 2C), magnesium-dependent, gamma isoform
chicken(421986) protein phosphatase, Mg2+/Mn2+ dependent, 1G
dog(475703) protein phosphatase, Mg2+/Mn2+ dependent, 1G
domestic cat(101097232) protein phosphatase, Mg2+/Mn2+ dependent, 1G
naked mole-rat(101716550) protein phosphatase, Mg2+/Mn2+ dependent, 1G
domestic guinea pig(100731390) protein phosphatase, Mg2+/Mn2+ dependent, 1G
cow(286880) protein phosphatase, Mg2+/Mn2+ dependent, 1G
sheep(101118001) protein phosphatase, Mg2+/Mn2+ dependent, 1G
97 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002707 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002707 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002707 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008014 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008014 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008014 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002707 Rosetta Predictions human pricing
NM_177983 Rosetta Predictions human pricing
NM_147209 Rosetta Predictions rat pricing
NM_008014 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002707 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00080405 predicted 312
2 SASI_Hs01_00080406 predicted 1460
3 SASI_Hs01_00080407 predicted 1414
4 SASI_Hs01_00080408 predicted 306
5 SASI_Hs01_00080409 predicted 309
6 SASI_Hs01_00080410 predicted 403
7 SASI_Hs01_00080411 predicted 384
8 SASI_Hs01_00080412 predicted 1574
9 SASI_Hs01_00080413 predicted 1402
10 SASI_Hs01_00080414 predicted 1422
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177983 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00184472 predicted 420
2 SASI_Hs01_00184473 predicted 1561
3 SASI_Hs01_00184474 predicted 1511
4 SASI_Hs01_00184475 predicted 409
5 SASI_Hs01_00184476 predicted 406
6 SASI_Hs01_00184477 predicted 504
7 SASI_Hs01_00184478 predicted 489
8 SASI_Hs01_00184479 predicted 1675
9 SASI_Hs01_00184480 predicted 1505
10 SASI_Hs01_00184481 predicted 1522
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_147209 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00108005 predicted 1415
2 SASI_Rn01_00108007 predicted 865
3 SASI_Rn01_00108008 predicted 430
4 SASI_Rn01_00108009 predicted 379
5 SASI_Rn01_00108010 predicted 1593
6 SASI_Rn01_00108011 predicted 1193
7 SASI_Rn01_00108012 predicted 334
8 SASI_Rn01_00108013 predicted 462
9 SASI_Rn01_00108014 predicted 1278
10 SASI_Rn02_00268882 predicted 242
11 SASI_Rn01_00108006 predicted 278
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008014 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00099068 predicted 1420
2 SASI_Mm01_00099069 predicted 895
3 SASI_Mm01_00099070 predicted 869
4 SASI_Mm01_00099071 predicted 1410
5 SASI_Mm01_00099072 predicted 1596
6 SASI_Mm01_00099074 predicted 1201
7 SASI_Mm01_00099075 predicted 465
8 SASI_Mm02_00312952 predicted 594
9 SASI_Mm01_00099077 predicted 272
10 SASI_Mm02_00312953 predicted 790
11 SASI_Mm01_00099073 predicted 595
12 SASI_Mm01_00099076 predicted 247
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002707
VALIDATED
PPM1G MISSION shRNA Bacterial Glycerol Stock
protein phosphatase, Mg2+/Mn2+ dependent, 1G
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000001213    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_002707.x-2103s1c1
Sequence:CCGGGTACACTTTCAATCAACACTTCTCGAGAAGTGTTGATTGAAAGTGTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001216    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_002707.x-546s1c1
Sequence:CCGGGAAGAGGCTACCATGACTATTCTCGAGAATAGTCATGGTAGCCTCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_002707.x-1209s1c1
Sequence:CCGGCCAGAGGATGAAGTAGAACTACTCGAGTAGTTCTACTTCATCCTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001215    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_002707.x-1511s1c1
Sequence:CCGGGCTTCGGTTATTGTCATCCATCTCGAGATGGATGACAATAACCGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001217    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_002707.x-432s1c1
Sequence:CCGGGAAGTCATTAAAGAGCTGGCACTCGAGTGCCAGCTCTTTAATGACTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293487    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_002707.3-1114s21c1
Sequence:CCGGTACGAGGGAAGCAGTTGATTGCTCGAGCAATCAACTGCTTCCCTCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293418    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_002707.3-546s21c1
Sequence:CCGGGAAGAGGCTACCATGACTATTCTCGAGAATAGTCATGGTAGCCTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293419    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_002707.3-1342s21c1
Sequence:CCGGCACCTGAGGAACAGATGATTTCTCGAGAAATCATCTGTTCCTCAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293416    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_002707.3-2103s21c1
Sequence:CCGGGTACACTTTCAATCAACACTTCTCGAGAAGTGTTGATTGAAAGTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_002707.3-1511s21c1
Sequence:CCGGGCTTCGGTTATTGTCATCCATCTCGAGATGGATGACAATAACCGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002707
VALIDATED
PPM1G MISSION shRNA shRNA Plasmid DNA
protein phosphatase, Mg2+/Mn2+ dependent, 1G
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000001213    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_002707.x-2103s1c1
Sequence:CCGGGTACACTTTCAATCAACACTTCTCGAGAAGTGTTGATTGAAAGTGTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001216    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_002707.x-546s1c1
Sequence:CCGGGAAGAGGCTACCATGACTATTCTCGAGAATAGTCATGGTAGCCTCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_002707.x-1209s1c1
Sequence:CCGGCCAGAGGATGAAGTAGAACTACTCGAGTAGTTCTACTTCATCCTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001215    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_002707.x-1511s1c1
Sequence:CCGGGCTTCGGTTATTGTCATCCATCTCGAGATGGATGACAATAACCGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001217    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_002707.x-432s1c1
Sequence:CCGGGAAGTCATTAAAGAGCTGGCACTCGAGTGCCAGCTCTTTAATGACTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293487    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_002707.3-1114s21c1
Sequence:CCGGTACGAGGGAAGCAGTTGATTGCTCGAGCAATCAACTGCTTCCCTCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293418    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_002707.3-546s21c1
Sequence:CCGGGAAGAGGCTACCATGACTATTCTCGAGAATAGTCATGGTAGCCTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293419    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_002707.3-1342s21c1
Sequence:CCGGCACCTGAGGAACAGATGATTTCTCGAGAAATCATCTGTTCCTCAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293416    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_002707.3-2103s21c1
Sequence:CCGGGTACACTTTCAATCAACACTTCTCGAGAAGTGTTGATTGAAAGTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_002707.3-1511s21c1
Sequence:CCGGGCTTCGGTTATTGTCATCCATCTCGAGATGGATGACAATAACCGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002707
VALIDATED
PPM1G MISSION shRNA Lentiviral Transduction Particles
protein phosphatase, Mg2+/Mn2+ dependent, 1G
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000001213    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_002707.x-2103s1c1
Sequence:CCGGGTACACTTTCAATCAACACTTCTCGAGAAGTGTTGATTGAAAGTGTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001216    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_002707.x-546s1c1
Sequence:CCGGGAAGAGGCTACCATGACTATTCTCGAGAATAGTCATGGTAGCCTCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_002707.x-1209s1c1
Sequence:CCGGCCAGAGGATGAAGTAGAACTACTCGAGTAGTTCTACTTCATCCTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001215    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_002707.x-1511s1c1
Sequence:CCGGGCTTCGGTTATTGTCATCCATCTCGAGATGGATGACAATAACCGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001217    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_002707.x-432s1c1
Sequence:CCGGGAAGTCATTAAAGAGCTGGCACTCGAGTGCCAGCTCTTTAATGACTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293487    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_002707.3-1114s21c1
Sequence:CCGGTACGAGGGAAGCAGTTGATTGCTCGAGCAATCAACTGCTTCCCTCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293418    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_002707.3-546s21c1
Sequence:CCGGGAAGAGGCTACCATGACTATTCTCGAGAATAGTCATGGTAGCCTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293419    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_002707.3-1342s21c1
Sequence:CCGGCACCTGAGGAACAGATGATTTCTCGAGAAATCATCTGTTCCTCAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293416    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_002707.3-2103s21c1
Sequence:CCGGGTACACTTTCAATCAACACTTCTCGAGAAGTGTTGATTGAAAGTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_002707.3-1511s21c1
Sequence:CCGGGCTTCGGTTATTGTCATCCATCTCGAGATGGATGACAATAACCGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008014
VALIDATED
PPM1G MISSION shRNA Bacterial Glycerol Stock
protein phosphatase, Mg2+/Mn2+ dependent, 1G
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000081208    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008014.2-1869s1c1
Sequence:CCGGGCTTTCCTCAGCCCATTACAACTCGAGTTGTAATGGGCTGAGGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081211    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008014.2-496s1c1
Sequence:CCGGGAGGATGATAAAGACAAAGTACTCGAGTACTTTGTCTTTATCATCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008014.2-409s1c1
Sequence:CCGGGATGCCTTCTTGGCTATTGATCTCGAGATCAATAGCCAAGAAGGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008014.2-1519s1c1
Sequence:CCGGCTTCGGTTATTGTCATCCATTCTCGAGAATGGATGACAATAACCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008014.2-325s1c1
Sequence:CCGGGCCTTGTACTGTGCCAAATATCTCGAGATATTTGGCACAGTACAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008014.3-437s21c1
Sequence:CCGGTGACCACAGAGGAAGTCATTACTCGAGTAATGACTTCCTCTGTGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326874    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008014.3-1869s21c1
Sequence:CCGGGCTTTCCTCAGCCCATTACAACTCGAGTTGTAATGGGCTGAGGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306418    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008014.3-1268s21c1
Sequence:CCGGCCATGGATGGACGAGTCAATGCTCGAGCATTGACTCGTCCATCCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008014.3-496s21c1
Sequence:CCGGGAGGATGATAAAGACAAAGTACTCGAGTACTTTGTCTTTATCATCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008014.3-325s21c1
Sequence:CCGGGCCTTGTACTGTGCCAAATATCTCGAGATATTTGGCACAGTACAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008014
VALIDATED
PPM1G MISSION shRNA shRNA Plasmid DNA
protein phosphatase, Mg2+/Mn2+ dependent, 1G
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000081208    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008014.2-1869s1c1
Sequence:CCGGGCTTTCCTCAGCCCATTACAACTCGAGTTGTAATGGGCTGAGGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081211    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008014.2-496s1c1
Sequence:CCGGGAGGATGATAAAGACAAAGTACTCGAGTACTTTGTCTTTATCATCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008014.2-409s1c1
Sequence:CCGGGATGCCTTCTTGGCTATTGATCTCGAGATCAATAGCCAAGAAGGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008014.2-1519s1c1
Sequence:CCGGCTTCGGTTATTGTCATCCATTCTCGAGAATGGATGACAATAACCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008014.2-325s1c1
Sequence:CCGGGCCTTGTACTGTGCCAAATATCTCGAGATATTTGGCACAGTACAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008014.3-437s21c1
Sequence:CCGGTGACCACAGAGGAAGTCATTACTCGAGTAATGACTTCCTCTGTGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326874    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008014.3-1869s21c1
Sequence:CCGGGCTTTCCTCAGCCCATTACAACTCGAGTTGTAATGGGCTGAGGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306418    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008014.3-1268s21c1
Sequence:CCGGCCATGGATGGACGAGTCAATGCTCGAGCATTGACTCGTCCATCCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008014.3-496s21c1
Sequence:CCGGGAGGATGATAAAGACAAAGTACTCGAGTACTTTGTCTTTATCATCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008014.3-325s21c1
Sequence:CCGGGCCTTGTACTGTGCCAAATATCTCGAGATATTTGGCACAGTACAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008014
VALIDATED
PPM1G MISSION shRNA Lentiviral Transduction Particles
protein phosphatase, Mg2+/Mn2+ dependent, 1G
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000081208    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008014.2-1869s1c1
Sequence:CCGGGCTTTCCTCAGCCCATTACAACTCGAGTTGTAATGGGCTGAGGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081211    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008014.2-496s1c1
Sequence:CCGGGAGGATGATAAAGACAAAGTACTCGAGTACTTTGTCTTTATCATCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008014.2-409s1c1
Sequence:CCGGGATGCCTTCTTGGCTATTGATCTCGAGATCAATAGCCAAGAAGGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008014.2-1519s1c1
Sequence:CCGGCTTCGGTTATTGTCATCCATTCTCGAGAATGGATGACAATAACCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008014.2-325s1c1
Sequence:CCGGGCCTTGTACTGTGCCAAATATCTCGAGATATTTGGCACAGTACAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008014.3-437s21c1
Sequence:CCGGTGACCACAGAGGAAGTCATTACTCGAGTAATGACTTCCTCTGTGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326874    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008014.3-1869s21c1
Sequence:CCGGGCTTTCCTCAGCCCATTACAACTCGAGTTGTAATGGGCTGAGGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306418    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008014.3-1268s21c1
Sequence:CCGGCCATGGATGGACGAGTCAATGCTCGAGCATTGACTCGTCCATCCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008014.3-496s21c1
Sequence:CCGGGAGGATGATAAAGACAAAGTACTCGAGTACTTTGTCTTTATCATCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008014.3-325s21c1
Sequence:CCGGGCCTTGTACTGTGCCAAATATCTCGAGATATTTGGCACAGTACAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks