EMAIL THIS PAGE TO A FRIEND

PPM1K

protein phosphatase, Mg2+/Mn2+ dependent, 1K

Synonyms: BDP MSUDMV PP2Ckappa PP2Cm PTMP UG0882E07
Gene ID:
Human(152926) Summary: This gene encodes a member of the PPM family of Mn2+/Mg2+-dependent protein phosphatases. The encoded protein, essential for cell survival and development, is targeted to the mitochondria where it plays a key role in regulation of the mitochondrial permeability transition pore. [provided by RefSeq, Sep 2012]
Mouse(243382) protein phosphatase 1K (PP2C domain containing)
Rat(312381) protein phosphatase, Mg2+/Mn2+ dependent, 1K
cow(540329) protein phosphatase, Mg2+/Mn2+ dependent, 1K
sheep(101119821) protein phosphatase, Mg2+/Mn2+ dependent, 1K
domestic guinea pig(100723717) protein phosphatase, Mg2+/Mn2+ dependent, 1K
naked mole-rat(101723582) protein phosphatase, Mg2+/Mn2+ dependent, 1K
Domestic Rabbit(100340852) protein phosphatase, Mg2+/Mn2+ dependent, 1K
Zebrafish(503713) protein phosphatase 1K (PP2C domain containing)
Horse(100063504) protein phosphatase, Mg2+/Mn2+ dependent, 1K
domestic cat(101093770) protein phosphatase, Mg2+/Mn2+ dependent, 1K
dog(478473) protein phosphatase, Mg2+/Mn2+ dependent, 1K
chicken(422614) protein phosphatase, Mg2+/Mn2+ dependent, 1K
88 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152542 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152542 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152542 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175523 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175523 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175523 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU132591 MISSION® esiRNA esiRNA human PPM1K (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152542 Rosetta Predictions human pricing
NM_001107863 Rosetta Predictions rat pricing
NM_175523 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152542 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00075245 predicted 1304
2 SASI_Hs01_00075246 predicted 1580
3 SASI_Hs01_00075247 predicted 1392
4 SASI_Hs01_00075248 predicted 738
5 SASI_Hs01_00075249 predicted 623
6 SASI_Hs01_00075250 predicted 813
7 SASI_Hs01_00075251 predicted 684
8 SASI_Hs01_00075252 predicted 1516
9 SASI_Hs01_00075253 predicted 591
10 SASI_Hs02_00366343 predicted 964
11 SASI_Hs01_00075244 predicted 1313
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107863 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00233025 predicted 937
2 SASI_Rn02_00233026 predicted 1148
3 SASI_Rn02_00233027 predicted 995
4 SASI_Rn02_00233028 predicted 1068
5 SASI_Rn02_00233029 predicted 501
6 SASI_Rn02_00233030 predicted 1492
7 SASI_Rn02_00233031 predicted 997
8 SASI_Rn02_00233032 predicted 485
9 SASI_Rn02_00233033 predicted 643
10 SASI_Rn02_00233034 predicted 526
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175523 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00346455 predicted 1286
2 SASI_Mm02_00346456 predicted 1008
3 SASI_Mm02_00346457 predicted 570
4 SASI_Mm02_00346458 predicted 945
5 SASI_Mm02_00346459 predicted 427
6 SASI_Mm02_00346460 predicted 577
7 SASI_Mm02_00346461 predicted 579
8 SASI_Mm02_00346462 predicted 518
9 SASI_Mm02_00346463 predicted 1101
10 SASI_Mm02_00346464 predicted 271
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152542
PPM1K MISSION shRNA Bacterial Glycerol Stock
protein phosphatase, Mg2+/Mn2+ dependent, 1K
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000363120    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152542.3-1604s21c1
Sequence:CCGGCAGCGCACAAGTCAGTGTAAACTCGAGTTTACACTGACTTGTGCGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363085    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152542.3-1705s21c1
Sequence:CCGGTGAAGCTACTGTGAGTCTTTACTCGAGTAAAGACTCACAGTAGCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152542.3-1222s21c1
Sequence:CCGGCCTGAAACTAAGAGGATTAAGCTCGAGCTTAATCCTCTTAGTTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363116    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152542.3-968s21c1
Sequence:CCGGCCCTATTGCGAGATGGTATTGCTCGAGCAATACCATCTCGCAATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152542.x-561s1c1
Sequence:CCGGGAAAGAGAATGAAGATCGGTTCTCGAGAACCGATCTTCATTCTCTTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002728    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152542.x-1452s1c1
Sequence:CCGGACTCACTAGATCAGCGCACAACTCGAGTTGTGCGCTGATCTAGTGAGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152542.x-835s1c1
Sequence:CCGGCGAGATGGTATTGAACTGGTTCTCGAGAACCAGTTCAATACCATCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152542.x-1037s1c1
Sequence:CCGGGTATTGGAGATTTGGACCTTACTCGAGTAAGGTCCAAATCTCCAATACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152542.x-917s1c1
Sequence:CCGGCCATTGACCATACTCCAGAAACTCGAGTTTCTGGAGTATGGTCAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152542
PPM1K MISSION shRNA shRNA Plasmid DNA
protein phosphatase, Mg2+/Mn2+ dependent, 1K
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000363120    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152542.3-1604s21c1
Sequence:CCGGCAGCGCACAAGTCAGTGTAAACTCGAGTTTACACTGACTTGTGCGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363085    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152542.3-1705s21c1
Sequence:CCGGTGAAGCTACTGTGAGTCTTTACTCGAGTAAAGACTCACAGTAGCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152542.3-1222s21c1
Sequence:CCGGCCTGAAACTAAGAGGATTAAGCTCGAGCTTAATCCTCTTAGTTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363116    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152542.3-968s21c1
Sequence:CCGGCCCTATTGCGAGATGGTATTGCTCGAGCAATACCATCTCGCAATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152542.x-561s1c1
Sequence:CCGGGAAAGAGAATGAAGATCGGTTCTCGAGAACCGATCTTCATTCTCTTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002728    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152542.x-1452s1c1
Sequence:CCGGACTCACTAGATCAGCGCACAACTCGAGTTGTGCGCTGATCTAGTGAGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152542.x-835s1c1
Sequence:CCGGCGAGATGGTATTGAACTGGTTCTCGAGAACCAGTTCAATACCATCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152542.x-1037s1c1
Sequence:CCGGGTATTGGAGATTTGGACCTTACTCGAGTAAGGTCCAAATCTCCAATACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152542.x-917s1c1
Sequence:CCGGCCATTGACCATACTCCAGAAACTCGAGTTTCTGGAGTATGGTCAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152542
PPM1K MISSION shRNA Lentiviral Transduction Particles
protein phosphatase, Mg2+/Mn2+ dependent, 1K
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000363120    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152542.3-1604s21c1
Sequence:CCGGCAGCGCACAAGTCAGTGTAAACTCGAGTTTACACTGACTTGTGCGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363085    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152542.3-1705s21c1
Sequence:CCGGTGAAGCTACTGTGAGTCTTTACTCGAGTAAAGACTCACAGTAGCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152542.3-1222s21c1
Sequence:CCGGCCTGAAACTAAGAGGATTAAGCTCGAGCTTAATCCTCTTAGTTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363116    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152542.3-968s21c1
Sequence:CCGGCCCTATTGCGAGATGGTATTGCTCGAGCAATACCATCTCGCAATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152542.x-561s1c1
Sequence:CCGGGAAAGAGAATGAAGATCGGTTCTCGAGAACCGATCTTCATTCTCTTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002728    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152542.x-1452s1c1
Sequence:CCGGACTCACTAGATCAGCGCACAACTCGAGTTGTGCGCTGATCTAGTGAGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152542.x-835s1c1
Sequence:CCGGCGAGATGGTATTGAACTGGTTCTCGAGAACCAGTTCAATACCATCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152542.x-1037s1c1
Sequence:CCGGGTATTGGAGATTTGGACCTTACTCGAGTAAGGTCCAAATCTCCAATACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152542.x-917s1c1
Sequence:CCGGCCATTGACCATACTCCAGAAACTCGAGTTTCTGGAGTATGGTCAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175523
VALIDATED
PPM1K MISSION shRNA Bacterial Glycerol Stock
protein phosphatase, Mg2+/Mn2+ dependent, 1K
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000081373    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175523.3-4361s1c1
Sequence:CCGGGCCTGATTCTACCTGAAAGAACTCGAGTTCTTTCAGGTAGAATCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081374    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175523.3-460s1c1
Sequence:CCGGCCTAGCATCAAGTACGGCAAACTCGAGTTTGCCGTACTTGATGCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081377    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175523.3-996s1c1
Sequence:CCGGACTTGCAATGACAAGGAGTATCTCGAGATACTCCTTGTCATTGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175523.3-947s1c1
Sequence:CCGGGTGGGTTTGTAGCTTGGAATACTCGAGTATTCCAAGCTACAAACCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081375    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175523.3-1287s1c1
Sequence:CCGGCTCTGAAATTACCTTCTCATTCTCGAGAATGAGAAGGTAATTTCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175523
VALIDATED
PPM1K MISSION shRNA shRNA Plasmid DNA
protein phosphatase, Mg2+/Mn2+ dependent, 1K
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000081373    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175523.3-4361s1c1
Sequence:CCGGGCCTGATTCTACCTGAAAGAACTCGAGTTCTTTCAGGTAGAATCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081374    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175523.3-460s1c1
Sequence:CCGGCCTAGCATCAAGTACGGCAAACTCGAGTTTGCCGTACTTGATGCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081377    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175523.3-996s1c1
Sequence:CCGGACTTGCAATGACAAGGAGTATCTCGAGATACTCCTTGTCATTGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175523.3-947s1c1
Sequence:CCGGGTGGGTTTGTAGCTTGGAATACTCGAGTATTCCAAGCTACAAACCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081375    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175523.3-1287s1c1
Sequence:CCGGCTCTGAAATTACCTTCTCATTCTCGAGAATGAGAAGGTAATTTCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175523
VALIDATED
PPM1K MISSION shRNA Lentiviral Transduction Particles
protein phosphatase, Mg2+/Mn2+ dependent, 1K
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000081373    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175523.3-4361s1c1
Sequence:CCGGGCCTGATTCTACCTGAAAGAACTCGAGTTCTTTCAGGTAGAATCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081374    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175523.3-460s1c1
Sequence:CCGGCCTAGCATCAAGTACGGCAAACTCGAGTTTGCCGTACTTGATGCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081377    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175523.3-996s1c1
Sequence:CCGGACTTGCAATGACAAGGAGTATCTCGAGATACTCCTTGTCATTGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175523.3-947s1c1
Sequence:CCGGGTGGGTTTGTAGCTTGGAATACTCGAGTATTCCAAGCTACAAACCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081375    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175523.3-1287s1c1
Sequence:CCGGCTCTGAAATTACCTTCTCATTCTCGAGAATGAGAAGGTAATTTCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks