EMAIL THIS PAGE TO A FRIEND

PPP1R14A

protein phosphatase 1, regulatory (inhibitor) subunit 14A

Synonyms: CPI-17 CPI17 PPP1INL
UniProtKB ID: Q96A00, Q7Z4X7, Q96S54
Gene ID:
Human(94274) Summary: The protein encoded by this gene belongs to the protein phosphatase 1 (PP1) inhibitor family. This protein is an inhibitor of smooth muscle myosin phosphatase, and has higher inhibitory activity when phosphorylated. Inhibition of myosin phosphatase leads to increased myosin phosphorylation and enhanced smooth muscle contraction. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene. [provided by RefSeq, Sep 2011]
Mouse(68458) protein phosphatase 1, regulatory (inhibitor) subunit 14A
Rat(114004) protein phosphatase 1, regulatory (inhibitor) subunit 14A
cow(615348) protein phosphatase 1, regulatory (inhibitor) subunit 14A
sheep(101110786) protein phosphatase 1, regulatory (inhibitor) subunit 14A
sheep(641304) protein phosphatase 1, regulatory (inhibitor) subunit 14A
naked mole-rat(101725214) protein phosphatase 1, regulatory (inhibitor) subunit 14A
domestic guinea pig(100725906) protein phosphatase 1, regulatory (inhibitor) subunit 14A
dog(612579) protein phosphatase 1, regulatory (inhibitor) subunit 14A
domestic cat(101096433) protein phosphatase 1, regulatory (inhibitor) subunit 14A
62 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_033256 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033256 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033256 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026731 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026731 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026731 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU149561 MISSION® esiRNA esiRNA human PPP1R14A (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_033256 Rosetta Predictions human pricing
NM_130403 Rosetta Predictions rat pricing
NM_026731 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033256 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00120916 predicted 391
2 SASI_Hs01_00120917 predicted 468
3 SASI_Hs01_00120918 predicted 475
4 SASI_Hs01_00120919 predicted 394
5 SASI_Hs01_00120920 predicted 419
6 SASI_Hs01_00120921 predicted 485
7 SASI_Hs01_00120922 predicted 487
8 SASI_Hs01_00120923 predicted 471
9 SASI_Hs01_00120924 predicted 389
10 SASI_Hs02_00361055 predicted 330
11 SASI_Hs01_00120925 predicted 414
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130403 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00267389 predicted 235
2 SASI_Rn01_00120096 predicted 273
3 SASI_Rn01_00120097 predicted 255
4 SASI_Rn01_00120098 predicted 299
5 SASI_Rn01_00120100 predicted 312
6 SASI_Rn01_00120101 predicted 245
7 SASI_Rn01_00120102 predicted 251
8 SASI_Rn02_00267390 predicted 224
9 SASI_Rn01_00120103 predicted 309
10 SASI_Rn01_00120104 predicted 214
11 SASI_Rn01_00120095 predicted 308
12 SASI_Rn01_00120099 predicted 236
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026731 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00096885 predicted 239
2 SASI_Mm01_00096886 predicted 243
3 SASI_Mm01_00096887 predicted 234
4 SASI_Mm01_00096888 predicted 229
5 SASI_Mm01_00096889 predicted 239
6 SASI_Mm02_00330776 predicted 204
7 SASI_Mm01_00096890 predicted 292
8 SASI_Mm01_00096891 predicted 212
9 SASI_Mm01_00096892 predicted 300
10 SASI_Mm01_00096893 predicted 246
11 SASI_Mm01_00096894 predicted 244
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033256
VALIDATED
PPP1R14A MISSION shRNA Bacterial Glycerol Stock
protein phosphatase 1, regulatory (inhibitor) subunit 14A
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000382075    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033256.1-499s21c1
Sequence:GTACCGGACCTGTCGAGGACTTCATCCACTCGAGTGGATGAAGTCCTCGACAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272608    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_033256.1-428s21c1
Sequence:CCGGGAATTGTTGGAGTTAGAGAGTCTCGAGACTCTCTAACTCCAACAATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272609    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_033256.1-402s21c1
Sequence:CCGGACATGCCCGATGAGATCAACACTCGAGTGTTGATCTCATCGGGCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272611    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_033256.1-487s21c1
Sequence:CCGGGTCATGTGGGAAACCTGTCGACTCGAGTCGACAGGTTTCCCACATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_033256.1-521s21c1
Sequence:CCGGGAGCTGCTGGCAAAGCTTCAACTCGAGTTGAAGCTTTGCCAGCAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_033256.1-298s21c1
Sequence:CCGGGCGCGTCACCGTCAAGTATGACTCGAGTCATACTTGACGGTGACGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033256.1-449s21c1
Sequence:GTACCGGGAAGAGGAGAGAAGCCGGAAACTCGAGTTTCCGGCTTCTCTCCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033256.1-413s21c1
Sequence:GTACCGGGAGATCAACATTGATGAATTGCTCGAGCAATTCATCAATGTTGATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_033256.1-487s1c1
Sequence:CCGGGTCATGTGGGAAACCTGTCGACTCGAGTCGACAGGTTTCCCACATGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006944    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_033256.1-428s1c1
Sequence:CCGGGAATTGTTGGAGTTAGAGAGTCTCGAGACTCTCTAACTCCAACAATTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033256.1-438s1c1
Sequence:CCGGAGTTAGAGAGTGAAGAGGAGACTCGAGTCTCCTCTTCACTCTCTAACTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006947    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_033256.1-432s1c1
Sequence:CCGGTGTTGGAGTTAGAGAGTGAAGCTCGAGCTTCACTCTCTAACTCCAACATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033256.1-484s1c1
Sequence:CCGGGAAGTCATGTGGGAAACCTGTCTCGAGACAGGTTTCCCACATGACTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033256
VALIDATED
PPP1R14A MISSION shRNA shRNA Plasmid DNA
protein phosphatase 1, regulatory (inhibitor) subunit 14A
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000382075    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033256.1-499s21c1
Sequence:GTACCGGACCTGTCGAGGACTTCATCCACTCGAGTGGATGAAGTCCTCGACAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272608    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_033256.1-428s21c1
Sequence:CCGGGAATTGTTGGAGTTAGAGAGTCTCGAGACTCTCTAACTCCAACAATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272609    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_033256.1-402s21c1
Sequence:CCGGACATGCCCGATGAGATCAACACTCGAGTGTTGATCTCATCGGGCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272611    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_033256.1-487s21c1
Sequence:CCGGGTCATGTGGGAAACCTGTCGACTCGAGTCGACAGGTTTCCCACATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_033256.1-521s21c1
Sequence:CCGGGAGCTGCTGGCAAAGCTTCAACTCGAGTTGAAGCTTTGCCAGCAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_033256.1-298s21c1
Sequence:CCGGGCGCGTCACCGTCAAGTATGACTCGAGTCATACTTGACGGTGACGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033256.1-449s21c1
Sequence:GTACCGGGAAGAGGAGAGAAGCCGGAAACTCGAGTTTCCGGCTTCTCTCCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033256.1-413s21c1
Sequence:GTACCGGGAGATCAACATTGATGAATTGCTCGAGCAATTCATCAATGTTGATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_033256.1-487s1c1
Sequence:CCGGGTCATGTGGGAAACCTGTCGACTCGAGTCGACAGGTTTCCCACATGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006944    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_033256.1-428s1c1
Sequence:CCGGGAATTGTTGGAGTTAGAGAGTCTCGAGACTCTCTAACTCCAACAATTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033256.1-438s1c1
Sequence:CCGGAGTTAGAGAGTGAAGAGGAGACTCGAGTCTCCTCTTCACTCTCTAACTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006947    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_033256.1-432s1c1
Sequence:CCGGTGTTGGAGTTAGAGAGTGAAGCTCGAGCTTCACTCTCTAACTCCAACATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033256.1-484s1c1
Sequence:CCGGGAAGTCATGTGGGAAACCTGTCTCGAGACAGGTTTCCCACATGACTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033256
VALIDATED
PPP1R14A MISSION shRNA Lentiviral Transduction Particles
protein phosphatase 1, regulatory (inhibitor) subunit 14A
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000382075    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033256.1-499s21c1
Sequence:GTACCGGACCTGTCGAGGACTTCATCCACTCGAGTGGATGAAGTCCTCGACAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272608    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_033256.1-428s21c1
Sequence:CCGGGAATTGTTGGAGTTAGAGAGTCTCGAGACTCTCTAACTCCAACAATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272609    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_033256.1-402s21c1
Sequence:CCGGACATGCCCGATGAGATCAACACTCGAGTGTTGATCTCATCGGGCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272611    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_033256.1-487s21c1
Sequence:CCGGGTCATGTGGGAAACCTGTCGACTCGAGTCGACAGGTTTCCCACATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_033256.1-521s21c1
Sequence:CCGGGAGCTGCTGGCAAAGCTTCAACTCGAGTTGAAGCTTTGCCAGCAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_033256.1-298s21c1
Sequence:CCGGGCGCGTCACCGTCAAGTATGACTCGAGTCATACTTGACGGTGACGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033256.1-449s21c1
Sequence:GTACCGGGAAGAGGAGAGAAGCCGGAAACTCGAGTTTCCGGCTTCTCTCCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033256.1-413s21c1
Sequence:GTACCGGGAGATCAACATTGATGAATTGCTCGAGCAATTCATCAATGTTGATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_033256.1-487s1c1
Sequence:CCGGGTCATGTGGGAAACCTGTCGACTCGAGTCGACAGGTTTCCCACATGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006944    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_033256.1-428s1c1
Sequence:CCGGGAATTGTTGGAGTTAGAGAGTCTCGAGACTCTCTAACTCCAACAATTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033256.1-438s1c1
Sequence:CCGGAGTTAGAGAGTGAAGAGGAGACTCGAGTCTCCTCTTCACTCTCTAACTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006947    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_033256.1-432s1c1
Sequence:CCGGTGTTGGAGTTAGAGAGTGAAGCTCGAGCTTCACTCTCTAACTCCAACATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033256.1-484s1c1
Sequence:CCGGGAAGTCATGTGGGAAACCTGTCTCGAGACAGGTTTCCCACATGACTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026731
PPP1R14A MISSION shRNA Bacterial Glycerol Stock
protein phosphatase 1, regulatory (inhibitor) subunit 14A
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000201383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026731.2-250s1c1
Sequence:CCGGGAGCTATTGGAATTGGACAGTCTCGAGACTGTCCAATTCCAATAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026731.2-259s1c1
Sequence:CCGGGAATTGGACAGTGAAGAGGAACTCGAGTTCCTCTTCACTGTCCAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026731.2-238s1c1
Sequence:CCGGGTCAACATCGATGAGCTATTGCTCGAGCAATAGCTCATCGATGTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026731.2-271s1c1
Sequence:CCGGGAAGAGGAAAGATGCCGGAAACTCGAGTTTCCGGCATCTTTCCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026731.2-247s1c1
Sequence:CCGGGATGAGCTATTGGAATTGGACCTCGAGGTCCAATTCCAATAGCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026731
PPP1R14A MISSION shRNA shRNA Plasmid DNA
protein phosphatase 1, regulatory (inhibitor) subunit 14A
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000201383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026731.2-250s1c1
Sequence:CCGGGAGCTATTGGAATTGGACAGTCTCGAGACTGTCCAATTCCAATAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026731.2-259s1c1
Sequence:CCGGGAATTGGACAGTGAAGAGGAACTCGAGTTCCTCTTCACTGTCCAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026731.2-238s1c1
Sequence:CCGGGTCAACATCGATGAGCTATTGCTCGAGCAATAGCTCATCGATGTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026731.2-271s1c1
Sequence:CCGGGAAGAGGAAAGATGCCGGAAACTCGAGTTTCCGGCATCTTTCCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026731.2-247s1c1
Sequence:CCGGGATGAGCTATTGGAATTGGACCTCGAGGTCCAATTCCAATAGCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026731
PPP1R14A MISSION shRNA Lentiviral Transduction Particles
protein phosphatase 1, regulatory (inhibitor) subunit 14A
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000201383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026731.2-250s1c1
Sequence:CCGGGAGCTATTGGAATTGGACAGTCTCGAGACTGTCCAATTCCAATAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026731.2-259s1c1
Sequence:CCGGGAATTGGACAGTGAAGAGGAACTCGAGTTCCTCTTCACTGTCCAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026731.2-238s1c1
Sequence:CCGGGTCAACATCGATGAGCTATTGCTCGAGCAATAGCTCATCGATGTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026731.2-271s1c1
Sequence:CCGGGAAGAGGAAAGATGCCGGAAACTCGAGTTTCCGGCATCTTTCCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026731.2-247s1c1
Sequence:CCGGGATGAGCTATTGGAATTGGACCTCGAGGTCCAATTCCAATAGCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks