EMAIL THIS PAGE TO A FRIEND

PPP1R16A

protein phosphatase 1, regulatory subunit 16A

Synonyms: MYPT3
UniProtKB ID: Q96I34, D3DWM5
Gene ID:
Mouse(73062) protein phosphatase 1, regulatory (inhibitor) subunit 16A
Rat(362944) protein phosphatase 1, regulatory subunit 16A
dog(482099) protein phosphatase 1, regulatory subunit 16A
domestic cat(101081956) protein phosphatase 1, regulatory subunit 16A
cow(508701) protein phosphatase 1, regulatory subunit 16A
sheep(101110745) protein phosphatase 1, regulatory subunit 16A
naked mole-rat(101711841) protein phosphatase 1, regulatory subunit 16A
domestic guinea pig(100735525) protein phosphatase 1, regulatory subunit 16A
55 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032902 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032902 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032902 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_033371 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_033371 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_033371 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032902 Rosetta Predictions human pricing
NM_001130566 Rosetta Predictions rat pricing
NM_033371 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032902 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00058511 predicted 1682
2 SASI_Hs01_00058512 predicted 985
3 SASI_Hs01_00058513 predicted 944
4 SASI_Hs01_00058514 predicted 953
5 SASI_Hs01_00058515 predicted 1344
6 SASI_Hs01_00058516 predicted 1629
7 SASI_Hs01_00058517 predicted 1740
8 SASI_Hs01_00058518 predicted 1723
9 SASI_Hs01_00058519 predicted 794
10 SASI_Hs01_00058520 predicted 676
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001130566 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00255829 predicted 1521
2 SASI_Rn02_00255830 predicted 1628
3 SASI_Rn02_00255831 predicted 1321
4 SASI_Rn02_00255832 predicted 2067
5 SASI_Rn02_00255833 predicted 1053
6 SASI_Rn02_00255834 predicted 2353
7 SASI_Rn02_00255835 predicted 2058
8 SASI_Rn02_00255836 predicted 2091
9 SASI_Rn02_00255837 predicted 1512
10 SASI_Rn02_00255838 predicted 1247
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033371 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00119447 predicted 1628
2 SASI_Mm01_00119448 predicted 1103
3 SASI_Mm01_00119449 predicted 1606
4 SASI_Mm01_00119450 predicted 1138
5 SASI_Mm01_00119451 predicted 1293
6 SASI_Mm01_00119452 predicted 1336
7 SASI_Mm01_00119453 predicted 1630
8 SASI_Mm01_00119454 predicted 1510
9 SASI_Mm01_00119455 predicted 1384
10 SASI_Mm01_00119456 predicted 1042
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032902
VALIDATED
PPP1R16A MISSION shRNA Bacterial Glycerol Stock
protein phosphatase 1, regulatory subunit 16A
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000377267    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_032902.5-859s21c1
Sequence:CCGGCAATGCCTGTGACAGTGAGTGCTCGAGCACTCACTGTCACAGGCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367568    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032902.5-1340s21c1
Sequence:CCGGCTGAACGCAAAGTCCCTGATGCTCGAGCATCAGGGACTTTGCGTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032902.5-1002s21c1
Sequence:CCGGATGATGAGCAGACGCTGGACTCTCGAGAGTCCAGCGTCTGCTCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_032902.5-707s21c1
Sequence:CCGGGCCCGAAATGACCTGGAAGAACTCGAGTTCTTCCAGGTCATTTCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032902.5-951s21c1
Sequence:CCGGCCAATCTCCTGGCGGTCAACACTCGAGTGTTGACCGCCAGGAGATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032902.5-794s21c1
Sequence:CCGGCACCAGTGCTGCATTGATGATCTCGAGATCATCAATGCAGCACTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000284959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032902.5-2048s21c1
Sequence:CCGGCTCATGTGAGGCTGTTGCTCACTCGAGTGAGCAACAGCCTCACATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000284948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032902.5-1733s21c1
Sequence:CCGGCATCTATACTCCAAGCGACTACTCGAGTAGTCGCTTGGAGTATAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032902.x-897s1c1
Sequence:CCGGCCCTATGACCTGTGTGATGATCTCGAGATCATCACACAGGTCATAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032902.x-1250s1c1
Sequence:CCGGCCTGAACGCAAAGTCCCTGATCTCGAGATCAGGGACTTTGCGTTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_032902.x-1644s1c1
Sequence:CCGGCATCTATACTCCAAGCGACTACTCGAGTAGTCGCTTGGAGTATAGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032902.x-618s1c1
Sequence:CCGGGCCCGAAATGACCTGGAAGAACTCGAGTTCTTCCAGGTCATTTCGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032902
VALIDATED
PPP1R16A MISSION shRNA shRNA Plasmid DNA
protein phosphatase 1, regulatory subunit 16A
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000377267    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_032902.5-859s21c1
Sequence:CCGGCAATGCCTGTGACAGTGAGTGCTCGAGCACTCACTGTCACAGGCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367568    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032902.5-1340s21c1
Sequence:CCGGCTGAACGCAAAGTCCCTGATGCTCGAGCATCAGGGACTTTGCGTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032902.5-1002s21c1
Sequence:CCGGATGATGAGCAGACGCTGGACTCTCGAGAGTCCAGCGTCTGCTCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_032902.5-707s21c1
Sequence:CCGGGCCCGAAATGACCTGGAAGAACTCGAGTTCTTCCAGGTCATTTCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032902.5-951s21c1
Sequence:CCGGCCAATCTCCTGGCGGTCAACACTCGAGTGTTGACCGCCAGGAGATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032902.5-794s21c1
Sequence:CCGGCACCAGTGCTGCATTGATGATCTCGAGATCATCAATGCAGCACTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000284959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032902.5-2048s21c1
Sequence:CCGGCTCATGTGAGGCTGTTGCTCACTCGAGTGAGCAACAGCCTCACATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000284948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032902.5-1733s21c1
Sequence:CCGGCATCTATACTCCAAGCGACTACTCGAGTAGTCGCTTGGAGTATAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032902.x-897s1c1
Sequence:CCGGCCCTATGACCTGTGTGATGATCTCGAGATCATCACACAGGTCATAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032902.x-1250s1c1
Sequence:CCGGCCTGAACGCAAAGTCCCTGATCTCGAGATCAGGGACTTTGCGTTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_032902.x-1644s1c1
Sequence:CCGGCATCTATACTCCAAGCGACTACTCGAGTAGTCGCTTGGAGTATAGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032902.x-618s1c1
Sequence:CCGGGCCCGAAATGACCTGGAAGAACTCGAGTTCTTCCAGGTCATTTCGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032902
VALIDATED
PPP1R16A MISSION shRNA Lentiviral Transduction Particles
protein phosphatase 1, regulatory subunit 16A
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000377267    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_032902.5-859s21c1
Sequence:CCGGCAATGCCTGTGACAGTGAGTGCTCGAGCACTCACTGTCACAGGCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367568    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032902.5-1340s21c1
Sequence:CCGGCTGAACGCAAAGTCCCTGATGCTCGAGCATCAGGGACTTTGCGTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032902.5-1002s21c1
Sequence:CCGGATGATGAGCAGACGCTGGACTCTCGAGAGTCCAGCGTCTGCTCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_032902.5-707s21c1
Sequence:CCGGGCCCGAAATGACCTGGAAGAACTCGAGTTCTTCCAGGTCATTTCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032902.5-951s21c1
Sequence:CCGGCCAATCTCCTGGCGGTCAACACTCGAGTGTTGACCGCCAGGAGATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032902.5-794s21c1
Sequence:CCGGCACCAGTGCTGCATTGATGATCTCGAGATCATCAATGCAGCACTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000284959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032902.5-2048s21c1
Sequence:CCGGCTCATGTGAGGCTGTTGCTCACTCGAGTGAGCAACAGCCTCACATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000284948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032902.5-1733s21c1
Sequence:CCGGCATCTATACTCCAAGCGACTACTCGAGTAGTCGCTTGGAGTATAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032902.x-897s1c1
Sequence:CCGGCCCTATGACCTGTGTGATGATCTCGAGATCATCACACAGGTCATAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032902.x-1250s1c1
Sequence:CCGGCCTGAACGCAAAGTCCCTGATCTCGAGATCAGGGACTTTGCGTTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_032902.x-1644s1c1
Sequence:CCGGCATCTATACTCCAAGCGACTACTCGAGTAGTCGCTTGGAGTATAGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032902.x-618s1c1
Sequence:CCGGGCCCGAAATGACCTGGAAGAACTCGAGTTCTTCCAGGTCATTTCGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033371
VALIDATED
PPP1R16A MISSION shRNA Bacterial Glycerol Stock
protein phosphatase 1, regulatory subunit 16A
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000081264    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033371.2-1708s1c1
Sequence:CCGGCCTCGATGTATGTGGTGATGACTCGAGTCATCACCACATACATCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081267    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033371.2-1043s1c1
Sequence:CCGGGCCCGAAACGACTTGGAGGAACTCGAGTTCCTCCAAGTCGTTTCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081263    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033371.2-2390s1c1
Sequence:CCGGCCTCAGTATGGCAGGGTTCAACTCGAGTTGAACCCTGCCATACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033371.2-2087s1c1
Sequence:CCGGGATCGGAGTGTCTCCTATCATCTCGAGATGATAGGAGACACTCCGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033371.2-1299s1c1
Sequence:CCGGCAGTCAATTCCGATGGGAATACTCGAGTATTCCCATCGGAATTGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033371
VALIDATED
PPP1R16A MISSION shRNA shRNA Plasmid DNA
protein phosphatase 1, regulatory subunit 16A
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000081264    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033371.2-1708s1c1
Sequence:CCGGCCTCGATGTATGTGGTGATGACTCGAGTCATCACCACATACATCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081267    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033371.2-1043s1c1
Sequence:CCGGGCCCGAAACGACTTGGAGGAACTCGAGTTCCTCCAAGTCGTTTCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081263    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033371.2-2390s1c1
Sequence:CCGGCCTCAGTATGGCAGGGTTCAACTCGAGTTGAACCCTGCCATACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033371.2-2087s1c1
Sequence:CCGGGATCGGAGTGTCTCCTATCATCTCGAGATGATAGGAGACACTCCGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033371.2-1299s1c1
Sequence:CCGGCAGTCAATTCCGATGGGAATACTCGAGTATTCCCATCGGAATTGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033371
VALIDATED
PPP1R16A MISSION shRNA Lentiviral Transduction Particles
protein phosphatase 1, regulatory subunit 16A
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000081264    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033371.2-1708s1c1
Sequence:CCGGCCTCGATGTATGTGGTGATGACTCGAGTCATCACCACATACATCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081267    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033371.2-1043s1c1
Sequence:CCGGGCCCGAAACGACTTGGAGGAACTCGAGTTCCTCCAAGTCGTTTCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081263    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033371.2-2390s1c1
Sequence:CCGGCCTCAGTATGGCAGGGTTCAACTCGAGTTGAACCCTGCCATACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033371.2-2087s1c1
Sequence:CCGGGATCGGAGTGTCTCCTATCATCTCGAGATGATAGGAGACACTCCGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033371.2-1299s1c1
Sequence:CCGGCAGTCAATTCCGATGGGAATACTCGAGTATTCCCATCGGAATTGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks