EMAIL THIS PAGE TO A FRIEND

PPP1R1B

protein phosphatase 1, regulatory (inhibitor) subunit 1B

Synonyms: DARPP-32 DARPP32
UniProtKB ID: Q9UD71, Q547V9, Q547W0, Q9H7G1
Gene ID:
Human(84152) Summary: This gene encodes a bifunctional signal transduction molecule. Dopaminergic and glutamatergic receptor stimulation regulates its phosphorylation and function as a kinase or phosphatase inhibitor. As a target for dopamine, this gene may serve as a therapeutic target for neurologic and psychiatric disorders. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
Mouse(19049) protein phosphatase 1, regulatory (inhibitor) subunit 1B
Rat(360616) protein phosphatase 1, regulatory (inhibitor) subunit 1B
Zebrafish(100884132) protein phosphatase 1, regulatory (inhibitor) subunit 1B
domestic cat(101090972) protein phosphatase 1, regulatory (inhibitor) subunit 1B
dog(608394) protein phosphatase 1, regulatory (inhibitor) subunit 1B
chicken(426639) protein phosphatase 1, regulatory (inhibitor) subunit 1B
domestic guinea pig(100726824) protein phosphatase 1, regulatory (inhibitor) subunit 1B
naked mole-rat(101708486) protein phosphatase 1, regulatory (inhibitor) subunit 1B
cow(282459) protein phosphatase 1, regulatory (inhibitor) subunit 1B
sheep(101103077) protein phosphatase 1, regulatory (inhibitor) subunit 1B
137 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4503329 Anti-DARPP-32 antibody produced in rabbit affinity isolated antibody human, rat, mouse
immunohistochemistry, western blot pricing
SAB4503330 Anti-DARPP-32, N-Terminal antibody produced in rabbit affinity isolated antibody rat, human, mouse
immunohistochemistry, western blot pricing
SAB4504378 Anti-phospho-DARPP-32 (pThr34) antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, immunohistochemistry, western blot pricing
SAB4503758 Anti-phospho-DARPP-32 (pThr75) antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunohistochemistry, western blot pricing
D2568 Anti-phospho-DARPP32 (pThr34) antibody produced in rabbit buffered aqueous glycerol solution, affinity isolated antibody mouse, rat
western blot pricing
D2693 Anti-phospho-DARPP32 (pThr75) antibody produced in rabbit affinity isolated antibody, buffered aqueous glycerol solution, sufficient for 10 blots human, mouse
dot blot, western blot pricing
SAB4300150 Anti-phospho-PPP1R1B (pThr75) antibody produced in rabbit affinity isolated antibody mouse, rat, human
immunofluorescence pricing
SAB1408088 Anti-PPP1R1B antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
HPA061142 Anti-PPP1R1B antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
HPA048630 Anti-PPP1R1B antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution mouse, human
immunohistochemistry, western blot pricing
SAB1403394 Monoclonal Anti-PPP1R1B antibody produced in mouse clone 3G11, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144828 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_144828 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_144828 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032192 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032192 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032192 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032192 Rosetta Predictions human pricing
NM_181505 Rosetta Predictions human pricing
NM_138521 Rosetta Predictions rat pricing
XM_001081393 Rosetta Predictions rat pricing
NM_144828 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032192 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00215517 predicted 1138
2 SASI_Hs01_00215518 predicted 1376
3 SASI_Hs01_00215520 predicted 1368
4 SASI_Hs01_00215521 predicted 1371
5 SASI_Hs01_00215523 predicted 1548
6 SASI_Hs01_00215524 predicted 1530
7 SASI_Hs01_00215525 predicted 1461
8 SASI_Hs01_00215526 predicted 1329
9 SASI_Hs02_00359474 predicted 1205
10 SASI_Hs02_00359475 predicted 1220
11 SASI_Hs01_00215519 predicted 1484
12 SASI_Hs01_00215522 predicted 1193
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181505 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00202536 predicted 792
2 SASI_Hs01_00202537 predicted 1031
3 SASI_Hs01_00202539 predicted 1030
4 SASI_Hs01_00202540 predicted 1029
5 SASI_Hs01_00202542 predicted 1207
6 SASI_Hs01_00202543 predicted 1185
7 SASI_Hs01_00202544 predicted 1120
8 SASI_Hs01_00202545 predicted 982
9 SASI_Hs02_00370125 predicted 860
10 SASI_Hs02_00370126 predicted 880
11 SASI_Hs01_00202538 predicted 1138
12 SASI_Hs01_00202541 predicted 850
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138521 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00110020 predicted 1506
2 SASI_Rn02_00268138 predicted 1276
3 SASI_Rn01_00110022 predicted 1385
4 SASI_Rn02_00268139 predicted 529
5 SASI_Rn01_00110023 predicted 695
6 SASI_Rn01_00110024 predicted 1286
7 SASI_Rn01_00110025 predicted 564
8 SASI_Rn01_00110026 predicted 1162
9 SASI_Rn01_00110027 predicted 1150
10 SASI_Rn01_00110028 predicted 1499
11 SASI_Rn01_00110021 predicted 1207
12 SASI_Rn01_00110029 predicted 1375
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001081393 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00371699 predicted 657
2 SASI_Rn02_00371700 predicted 530
3 SASI_Rn02_00371701 predicted 568
4 SASI_Rn02_00371702 predicted 521
5 SASI_Rn02_00371703 predicted 438
6 SASI_Rn02_00371704 predicted 607
7 SASI_Rn02_00371705 predicted 522
8 SASI_Rn02_00371706 predicted 559
9 SASI_Rn02_00371707 predicted 431
10 SASI_Rn02_00371708 predicted 658
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144828 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00054816 predicted 1417
2 SASI_Mm01_00054817 predicted 611
3 SASI_Mm01_00054818 predicted 609
4 SASI_Mm01_00054819 predicted 1114
5 SASI_Mm01_00054820 predicted 1434
6 SASI_Mm01_00054821 predicted 876
7 SASI_Mm01_00054822 predicted 1190
8 SASI_Mm02_00340210 predicted 1363
9 SASI_Mm01_00054824 predicted 959
10 SASI_Mm02_00340211 predicted 1421
11 SASI_Mm01_00054823 predicted 1072
12 SASI_Mm01_00054825 predicted 1152
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144828
PPP1R1B MISSION shRNA Bacterial Glycerol Stock
protein phosphatase 1, regulatory (inhibitor) subunit 1B
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000105955    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144828.1-1014s1c1
Sequence:CCGGCCTCCTTTGTACCCTGTCTTTCTCGAGAAAGACAGGGTACAAAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144828.1-857s1c1
Sequence:CCGGAGATGGAAACTCTGAGGACCACTCGAGTGGTCCTCAGAGTTTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144828.1-617s1c1
Sequence:CCGGCATTAGCAACTTGAGTGAGAACTCGAGTTCTCACTCAAGTTGCTAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144828.1-545s1c1
Sequence:CCGGCCCAAAGTCGAAGAGACCCAACTCGAGTTGGGTCTCTTCGACTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105958    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144828.1-880s1c1
Sequence:CCGGTGGAAGGCAGAGCAACACTAACTCGAGTTAGTGTTGCTCTGCCTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144828
PPP1R1B MISSION shRNA shRNA Plasmid DNA
protein phosphatase 1, regulatory (inhibitor) subunit 1B
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000105955    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144828.1-1014s1c1
Sequence:CCGGCCTCCTTTGTACCCTGTCTTTCTCGAGAAAGACAGGGTACAAAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144828.1-857s1c1
Sequence:CCGGAGATGGAAACTCTGAGGACCACTCGAGTGGTCCTCAGAGTTTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144828.1-617s1c1
Sequence:CCGGCATTAGCAACTTGAGTGAGAACTCGAGTTCTCACTCAAGTTGCTAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144828.1-545s1c1
Sequence:CCGGCCCAAAGTCGAAGAGACCCAACTCGAGTTGGGTCTCTTCGACTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105958    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144828.1-880s1c1
Sequence:CCGGTGGAAGGCAGAGCAACACTAACTCGAGTTAGTGTTGCTCTGCCTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144828
PPP1R1B MISSION shRNA Lentiviral Transduction Particles
protein phosphatase 1, regulatory (inhibitor) subunit 1B
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000105955    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144828.1-1014s1c1
Sequence:CCGGCCTCCTTTGTACCCTGTCTTTCTCGAGAAAGACAGGGTACAAAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144828.1-857s1c1
Sequence:CCGGAGATGGAAACTCTGAGGACCACTCGAGTGGTCCTCAGAGTTTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144828.1-617s1c1
Sequence:CCGGCATTAGCAACTTGAGTGAGAACTCGAGTTCTCACTCAAGTTGCTAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144828.1-545s1c1
Sequence:CCGGCCCAAAGTCGAAGAGACCCAACTCGAGTTGGGTCTCTTCGACTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105958    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144828.1-880s1c1
Sequence:CCGGTGGAAGGCAGAGCAACACTAACTCGAGTTAGTGTTGCTCTGCCTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032192
PPP1R1B MISSION shRNA Bacterial Glycerol Stock
protein phosphatase 1, regulatory (inhibitor) subunit 1B
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000052878    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_032192.2-1813s1c1
Sequence:CCGGCCCGTGCTGTAATAAATCTTTCTCGAGAAAGATTTATTACAGCACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032192.2-685s1c1
Sequence:CCGGCCTACACACCACCTTCGCTGACTCGAGTCAGCGAAGGTGGTGTGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032192.2-686s1c1
Sequence:CCGGCTACACACCACCTTCGCTGAACTCGAGTTCAGCGAAGGTGGTGTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032192.2-687s1c1
Sequence:CCGGTACACACCACCTTCGCTGAAACTCGAGTTTCAGCGAAGGTGGTGTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052882    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_032192.2-1013s1c1
Sequence:CCGGGGAAGACCCAGCACTAAGTGACTCGAGTCACTTAGTGCTGGGTCTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000378408    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032192.2-1220s21c1
Sequence:CCGGTGGTCTGTGTTTGCTTGTTTGCTCGAGCAAACAAGCAAACACAGACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000378202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032192.2-688s21c1
Sequence:CCGGACACACCACCTTCGCTGAAAGCTCGAGCTTTCAGCGAAGGTGGTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000355617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032192.2-734s21c1
Sequence:CCGGCCTGCAGTCTATCAGCAATTTCTCGAGAAATTGCTGATAGACTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000355618    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032192.2-1581s21c1
Sequence:CCGGTTCTCCATAGCCTCAACATTTCTCGAGAAATGTTGAGGCTATGGAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032192
PPP1R1B MISSION shRNA shRNA Plasmid DNA
protein phosphatase 1, regulatory (inhibitor) subunit 1B
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000052878    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_032192.2-1813s1c1
Sequence:CCGGCCCGTGCTGTAATAAATCTTTCTCGAGAAAGATTTATTACAGCACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032192.2-685s1c1
Sequence:CCGGCCTACACACCACCTTCGCTGACTCGAGTCAGCGAAGGTGGTGTGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032192.2-686s1c1
Sequence:CCGGCTACACACCACCTTCGCTGAACTCGAGTTCAGCGAAGGTGGTGTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032192.2-687s1c1
Sequence:CCGGTACACACCACCTTCGCTGAAACTCGAGTTTCAGCGAAGGTGGTGTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052882    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_032192.2-1013s1c1
Sequence:CCGGGGAAGACCCAGCACTAAGTGACTCGAGTCACTTAGTGCTGGGTCTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000378408    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032192.2-1220s21c1
Sequence:CCGGTGGTCTGTGTTTGCTTGTTTGCTCGAGCAAACAAGCAAACACAGACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000378202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032192.2-688s21c1
Sequence:CCGGACACACCACCTTCGCTGAAAGCTCGAGCTTTCAGCGAAGGTGGTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000355617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032192.2-734s21c1
Sequence:CCGGCCTGCAGTCTATCAGCAATTTCTCGAGAAATTGCTGATAGACTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000355618    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032192.2-1581s21c1
Sequence:CCGGTTCTCCATAGCCTCAACATTTCTCGAGAAATGTTGAGGCTATGGAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032192
PPP1R1B MISSION shRNA Lentiviral Transduction Particles
protein phosphatase 1, regulatory (inhibitor) subunit 1B
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000052878    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_032192.2-1813s1c1
Sequence:CCGGCCCGTGCTGTAATAAATCTTTCTCGAGAAAGATTTATTACAGCACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032192.2-685s1c1
Sequence:CCGGCCTACACACCACCTTCGCTGACTCGAGTCAGCGAAGGTGGTGTGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032192.2-686s1c1
Sequence:CCGGCTACACACCACCTTCGCTGAACTCGAGTTCAGCGAAGGTGGTGTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032192.2-687s1c1
Sequence:CCGGTACACACCACCTTCGCTGAAACTCGAGTTTCAGCGAAGGTGGTGTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052882    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_032192.2-1013s1c1
Sequence:CCGGGGAAGACCCAGCACTAAGTGACTCGAGTCACTTAGTGCTGGGTCTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000378408    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032192.2-1220s21c1
Sequence:CCGGTGGTCTGTGTTTGCTTGTTTGCTCGAGCAAACAAGCAAACACAGACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000378202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032192.2-688s21c1
Sequence:CCGGACACACCACCTTCGCTGAAAGCTCGAGCTTTCAGCGAAGGTGGTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000355617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032192.2-734s21c1
Sequence:CCGGCCTGCAGTCTATCAGCAATTTCTCGAGAAATTGCTGATAGACTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000355618    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032192.2-1581s21c1
Sequence:CCGGTTCTCCATAGCCTCAACATTTCTCGAGAAATGTTGAGGCTATGGAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks