EMAIL THIS PAGE TO A FRIEND

PPP1R26

protein phosphatase 1, regulatory subunit 26

Synonyms: KIAA0649
UniProtKB ID: Q5T8A7, Q86WU0, Q8WVV0, Q9Y4D3
Gene ID:
Mouse(241289) protein phosphatase 1, regulatory subunit 26
Rat(685398) protein phosphatase 1, regulatory subunit 26
Zebrafish(571919) protein phosphatase 1, regulatory subunit 26
domestic cat(101081936) protein phosphatase 1, regulatory subunit 26
dog(491279) protein phosphatase 1, regulatory subunit 26
chicken(101750971) protein phosphatase 1, regulatory subunit 26
chicken(101664949) protein phosphatase 1, regulatory subunit 26
naked mole-rat(101726392) protein phosphatase 1, regulatory subunit 26
domestic guinea pig(100727677) protein phosphatase 1, regulatory subunit 26
cow(618652) protein phosphatase 1, regulatory subunit 26
sheep(101107271) protein phosphatase 1, regulatory subunit 26
65 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014811 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014811 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014811 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001005420 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001005420 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001005420 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU117381 MISSION® esiRNA esiRNA human KIAA0649 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014811 Rosetta Predictions human pricing
XM_001063635 Rosetta Predictions rat pricing
NM_001005420 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014811 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00158344 predicted 3403
2 SASI_Hs01_00158345 predicted 3940
3 SASI_Hs01_00158346 predicted 1542
4 SASI_Hs01_00158347 predicted 2636
5 SASI_Hs02_00346337 predicted 1984
6 SASI_Hs01_00158348 predicted 1543
7 SASI_Hs01_00158350 predicted 901
8 SASI_Hs01_00158351 predicted 4155
9 SASI_Hs01_00158352 predicted 1473
10 SASI_Hs01_00158353 predicted 2197
11 SASI_Hs01_00158349 predicted 1229
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001063635 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00307875 predicted 770
2 SASI_Rn02_00307876 predicted 726
3 SASI_Rn02_00307877 predicted 346
4 SASI_Rn02_00307878 predicted 2784
5 SASI_Rn02_00307879 predicted 2737
6 SASI_Rn02_00307880 predicted 1348
7 SASI_Rn02_00307881 predicted 3118
8 SASI_Rn02_00307882 predicted 2025
9 SASI_Rn02_00307883 predicted 1231
10 SASI_Rn02_00307884 predicted 1096
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005420 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00286578 predicted 2770
2 SASI_Mm01_00045465 predicted 3096
3 SASI_Mm01_00045466 predicted 2294
4 SASI_Mm01_00045467 predicted 3561
5 SASI_Mm01_00045468 predicted 1088
6 SASI_Mm01_00045469 predicted 1801
7 SASI_Mm01_00045470 predicted 2671
8 SASI_Mm01_00045471 predicted 2178
9 SASI_Mm01_00045472 predicted 1039
10 SASI_Mm01_00045473 predicted 3170
11 SASI_Mm01_00045474 predicted 2567
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014811
PPP1R26 MISSION shRNA Bacterial Glycerol Stock
protein phosphatase 1, regulatory subunit 26
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436339    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014811.3-4208s21c1
Sequence:CCGGGTTGCGTGCATTCGTGGAAAGCTCGAGCTTTCCACGAATGCACGCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014811.3-576s21c1
Sequence:CCGGGGTTGCTCTCCAGTCCAAATGCTCGAGCATTTGGACTGGAGAGCAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014811.3-2655s1c1
Sequence:CCGGGTCCAAGCGAAAGCTCAAGAACTCGAGTTCTTGAGCTTTCGCTTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133789    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014811.3-4463s1c1
Sequence:CCGGCTGCATACAAGTCTTAGCTTACTCGAGTAAGCTAAGACTTGTATGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014811.3-1227s1c1
Sequence:CCGGCAGGGCGGAAATAGAACAGTTCTCGAGAACTGTTCTATTTCCGCCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014811.3-2152s1c1
Sequence:CCGGGAGCAGGAAATCCGGACATTTCTCGAGAAATGTCCGGATTTCCTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138089    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014811.3-1431s1c1
Sequence:CCGGGTTAGCGAAGATGAACGTCCACTCGAGTGGACGTTCATCTTCGCTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014811.3-1989s1c1
Sequence:CCGGGCTGATGTGTGCAGAAGCAATCTCGAGATTGCTTCTGCACACATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137688    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014811.3-693s1c1
Sequence:CCGGGATGCTTATCAGCACTCTGCACTCGAGTGCAGAGTGCTGATAAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138435    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014811.3-2631s1c1
Sequence:CCGGCACAGCCATCAAGGACTTGTTCTCGAGAACAAGTCCTTGATGGCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014811
PPP1R26 MISSION shRNA shRNA Plasmid DNA
protein phosphatase 1, regulatory subunit 26
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436339    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014811.3-4208s21c1
Sequence:CCGGGTTGCGTGCATTCGTGGAAAGCTCGAGCTTTCCACGAATGCACGCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014811.3-576s21c1
Sequence:CCGGGGTTGCTCTCCAGTCCAAATGCTCGAGCATTTGGACTGGAGAGCAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014811.3-2655s1c1
Sequence:CCGGGTCCAAGCGAAAGCTCAAGAACTCGAGTTCTTGAGCTTTCGCTTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133789    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014811.3-4463s1c1
Sequence:CCGGCTGCATACAAGTCTTAGCTTACTCGAGTAAGCTAAGACTTGTATGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014811.3-1227s1c1
Sequence:CCGGCAGGGCGGAAATAGAACAGTTCTCGAGAACTGTTCTATTTCCGCCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014811.3-2152s1c1
Sequence:CCGGGAGCAGGAAATCCGGACATTTCTCGAGAAATGTCCGGATTTCCTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138089    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014811.3-1431s1c1
Sequence:CCGGGTTAGCGAAGATGAACGTCCACTCGAGTGGACGTTCATCTTCGCTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014811.3-1989s1c1
Sequence:CCGGGCTGATGTGTGCAGAAGCAATCTCGAGATTGCTTCTGCACACATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137688    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014811.3-693s1c1
Sequence:CCGGGATGCTTATCAGCACTCTGCACTCGAGTGCAGAGTGCTGATAAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138435    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014811.3-2631s1c1
Sequence:CCGGCACAGCCATCAAGGACTTGTTCTCGAGAACAAGTCCTTGATGGCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014811
PPP1R26 MISSION shRNA Lentiviral Transduction Particles
protein phosphatase 1, regulatory subunit 26
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436339    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014811.3-4208s21c1
Sequence:CCGGGTTGCGTGCATTCGTGGAAAGCTCGAGCTTTCCACGAATGCACGCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014811.3-576s21c1
Sequence:CCGGGGTTGCTCTCCAGTCCAAATGCTCGAGCATTTGGACTGGAGAGCAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014811.3-2655s1c1
Sequence:CCGGGTCCAAGCGAAAGCTCAAGAACTCGAGTTCTTGAGCTTTCGCTTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133789    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014811.3-4463s1c1
Sequence:CCGGCTGCATACAAGTCTTAGCTTACTCGAGTAAGCTAAGACTTGTATGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014811.3-1227s1c1
Sequence:CCGGCAGGGCGGAAATAGAACAGTTCTCGAGAACTGTTCTATTTCCGCCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014811.3-2152s1c1
Sequence:CCGGGAGCAGGAAATCCGGACATTTCTCGAGAAATGTCCGGATTTCCTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138089    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014811.3-1431s1c1
Sequence:CCGGGTTAGCGAAGATGAACGTCCACTCGAGTGGACGTTCATCTTCGCTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014811.3-1989s1c1
Sequence:CCGGGCTGATGTGTGCAGAAGCAATCTCGAGATTGCTTCTGCACACATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137688    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014811.3-693s1c1
Sequence:CCGGGATGCTTATCAGCACTCTGCACTCGAGTGCAGAGTGCTGATAAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138435    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014811.3-2631s1c1
Sequence:CCGGCACAGCCATCAAGGACTTGTTCTCGAGAACAAGTCCTTGATGGCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001005420
PPP1R26 MISSION shRNA Bacterial Glycerol Stock
protein phosphatase 1, regulatory subunit 26
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000217842    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005420.1-2347s1c1
Sequence:CCGGCCTGTAAGAAGGTCAGATTTGCTCGAGCAAATCTGACCTTCTTACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217833    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005420.1-2298s1c1
Sequence:CCGGCTAAGATCCAAGCGCAAGTTTCTCGAGAAACTTGCGCTTGGATCTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005420.1-2225s1c1
Sequence:CCGGGAAGGAAAGCTCTGAGGATAACTCGAGTTATCCTCAGAGCTTTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005420.1-945s1c1
Sequence:CCGGGCTGAAATAGAACAGTTTCTTCTCGAGAAGAAACTGTTCTATTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175552    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001005420.1-4329s1c1
Sequence:CCGGCCGCTTTGCTTGTGAAGATATCTCGAGATATCTTCACAAGCAAAGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193991    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005420.1-2730s1c1
Sequence:CCGGGAGTCTATACGCAACACAGAACTCGAGTTCTGTGTTGCGTATAGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005420.1-941s1c1
Sequence:CCGGCCGAGCTGAAATAGAACAGTTCTCGAGAACTGTTCTATTTCAGCTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001005420
PPP1R26 MISSION shRNA shRNA Plasmid DNA
protein phosphatase 1, regulatory subunit 26
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000217842    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005420.1-2347s1c1
Sequence:CCGGCCTGTAAGAAGGTCAGATTTGCTCGAGCAAATCTGACCTTCTTACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217833    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005420.1-2298s1c1
Sequence:CCGGCTAAGATCCAAGCGCAAGTTTCTCGAGAAACTTGCGCTTGGATCTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005420.1-2225s1c1
Sequence:CCGGGAAGGAAAGCTCTGAGGATAACTCGAGTTATCCTCAGAGCTTTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005420.1-945s1c1
Sequence:CCGGGCTGAAATAGAACAGTTTCTTCTCGAGAAGAAACTGTTCTATTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175552    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001005420.1-4329s1c1
Sequence:CCGGCCGCTTTGCTTGTGAAGATATCTCGAGATATCTTCACAAGCAAAGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193991    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005420.1-2730s1c1
Sequence:CCGGGAGTCTATACGCAACACAGAACTCGAGTTCTGTGTTGCGTATAGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005420.1-941s1c1
Sequence:CCGGCCGAGCTGAAATAGAACAGTTCTCGAGAACTGTTCTATTTCAGCTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001005420
PPP1R26 MISSION shRNA Lentiviral Transduction Particles
protein phosphatase 1, regulatory subunit 26
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000217842    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005420.1-2347s1c1
Sequence:CCGGCCTGTAAGAAGGTCAGATTTGCTCGAGCAAATCTGACCTTCTTACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217833    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005420.1-2298s1c1
Sequence:CCGGCTAAGATCCAAGCGCAAGTTTCTCGAGAAACTTGCGCTTGGATCTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005420.1-2225s1c1
Sequence:CCGGGAAGGAAAGCTCTGAGGATAACTCGAGTTATCCTCAGAGCTTTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005420.1-945s1c1
Sequence:CCGGGCTGAAATAGAACAGTTTCTTCTCGAGAAGAAACTGTTCTATTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175552    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001005420.1-4329s1c1
Sequence:CCGGCCGCTTTGCTTGTGAAGATATCTCGAGATATCTTCACAAGCAAAGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193991    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005420.1-2730s1c1
Sequence:CCGGGAGTCTATACGCAACACAGAACTCGAGTTCTGTGTTGCGTATAGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005420.1-941s1c1
Sequence:CCGGCCGAGCTGAAATAGAACAGTTCTCGAGAACTGTTCTATTTCAGCTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks