EMAIL THIS PAGE TO A FRIEND

PPP1R32

protein phosphatase 1, regulatory subunit 32

Synonyms: C11orf66 IIIG9
UniProtKB ID: Q7Z5V6, Q4G0P4, Q96M77
Gene ID:
Mouse(67752) protein phosphatase 1, regulatory subunit 32
Rat(252958) protein phosphatase 1, regulatory subunit 32
domestic cat(101084315) protein phosphatase 1, regulatory subunit 32
dog(612302) protein phosphatase 1, regulatory subunit 32
domestic guinea pig(100725826) protein phosphatase 1, regulatory subunit 32
cow(506337) protein phosphatase 1, regulatory subunit 32
sheep(101108090) protein phosphatase 1, regulatory subunit 32
50 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145017 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145017 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145017 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_133689 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133689 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133689 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_145017 Rosetta Predictions human pricing
NM_145786 Rosetta Predictions rat pricing
NM_133689 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145017 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00187896 predicted 865
2 SASI_Hs01_00187897 predicted 263
3 SASI_Hs01_00187898 predicted 631
4 SASI_Hs01_00187899 predicted 300
5 SASI_Hs01_00187900 predicted 681
6 SASI_Hs01_00187901 predicted 639
7 SASI_Hs01_00187902 predicted 255
8 SASI_Hs01_00187903 predicted 670
9 SASI_Hs02_00364869 predicted 642
10 SASI_Hs01_00187904 predicted 860
11 SASI_Hs01_00187895 predicted 1158
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145786 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00268795 predicted 521
2 SASI_Rn01_00111887 predicted 694
3 SASI_Rn01_00111888 predicted 660
4 SASI_Rn01_00111889 predicted 893
5 SASI_Rn02_00268796 predicted 700
6 SASI_Rn01_00111890 predicted 675
7 SASI_Rn01_00111891 predicted 392
8 SASI_Rn01_00111892 predicted 613
9 SASI_Rn01_00111893 predicted 627
10 SASI_Rn01_00111895 predicted 1143
11 SASI_Rn01_00111886 predicted 1099
12 SASI_Rn01_00111894 predicted 601
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133689 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00044813 predicted 794
2 SASI_Mm01_00044814 predicted 820
3 SASI_Mm01_00044815 predicted 684
4 SASI_Mm01_00044817 predicted 199
5 SASI_Mm01_00044818 predicted 712
6 SASI_Mm01_00044819 predicted 375
7 SASI_Mm02_00338648 predicted 867
8 SASI_Mm02_00338649 predicted 725
9 SASI_Mm01_00044820 predicted 901
10 SASI_Mm01_00044822 predicted 235
11 SASI_Mm01_00044816 predicted 619
12 SASI_Mm01_00044821 predicted 323
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145017
PPP1R32 MISSION shRNA Bacterial Glycerol Stock
protein phosphatase 1, regulatory subunit 32
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145017.1-830s1c1
Sequence:CCGGGAGTGTCACCAAGTCAGACTTCTCGAGAAGTCTGACTTGGTGACACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145017.1-1163s1c1
Sequence:CCGGCCAAGGGTACTTTGAGAACATCTCGAGATGTTCTCAAAGTACCCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145017.1-653s1c1
Sequence:CCGGGTCGGAGTACAATTCCAAGTACTCGAGTACTTGGAATTGTACTCCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135588    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145017.1-695s1c1
Sequence:CCGGGCCAGATTTCTTGCAGAAGAACTCGAGTTCTTCTGCAAGAAATCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145017.1-867s1c1
Sequence:CCGGCTACATGGAGATGAGTTCCTACTCGAGTAGGAACTCATCTCCATGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145017.1-710s1c1
Sequence:CCGGGAAGAAATCGATCGGCGCAAACTCGAGTTTGCGCCGATCGATTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145017
PPP1R32 MISSION shRNA shRNA Plasmid DNA
protein phosphatase 1, regulatory subunit 32
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145017.1-830s1c1
Sequence:CCGGGAGTGTCACCAAGTCAGACTTCTCGAGAAGTCTGACTTGGTGACACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145017.1-1163s1c1
Sequence:CCGGCCAAGGGTACTTTGAGAACATCTCGAGATGTTCTCAAAGTACCCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145017.1-653s1c1
Sequence:CCGGGTCGGAGTACAATTCCAAGTACTCGAGTACTTGGAATTGTACTCCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135588    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145017.1-695s1c1
Sequence:CCGGGCCAGATTTCTTGCAGAAGAACTCGAGTTCTTCTGCAAGAAATCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145017.1-867s1c1
Sequence:CCGGCTACATGGAGATGAGTTCCTACTCGAGTAGGAACTCATCTCCATGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145017.1-710s1c1
Sequence:CCGGGAAGAAATCGATCGGCGCAAACTCGAGTTTGCGCCGATCGATTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145017
PPP1R32 MISSION shRNA Lentiviral Transduction Particles
protein phosphatase 1, regulatory subunit 32
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145017.1-830s1c1
Sequence:CCGGGAGTGTCACCAAGTCAGACTTCTCGAGAAGTCTGACTTGGTGACACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145017.1-1163s1c1
Sequence:CCGGCCAAGGGTACTTTGAGAACATCTCGAGATGTTCTCAAAGTACCCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145017.1-653s1c1
Sequence:CCGGGTCGGAGTACAATTCCAAGTACTCGAGTACTTGGAATTGTACTCCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135588    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145017.1-695s1c1
Sequence:CCGGGCCAGATTTCTTGCAGAAGAACTCGAGTTCTTCTGCAAGAAATCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145017.1-867s1c1
Sequence:CCGGCTACATGGAGATGAGTTCCTACTCGAGTAGGAACTCATCTCCATGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145017.1-710s1c1
Sequence:CCGGGAAGAAATCGATCGGCGCAAACTCGAGTTTGCGCCGATCGATTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133689
PPP1R32 MISSION shRNA Bacterial Glycerol Stock
protein phosphatase 1, regulatory subunit 32
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000198484    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133689.1-802s1c1
Sequence:CCGGGAGTATCACCAAGTCAGACTACTCGAGTAGTCTGACTTGGTGATACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181919    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133689.1-901s1c1
Sequence:CCGGCCGAGTGAATGAAAGGACCTTCTCGAGAAGGTCCTTTCATTCACTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177897    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133689.1-1051s1c1
Sequence:CCGGCACAGGGTTCACTCTTAACAACTCGAGTTGTTAAGAGTGAACCCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133689.1-377s21c1
Sequence:CCGGCTAGAAGTGCCCGATGGTAAACTCGAGTTTACCATCGGGCACTTCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264376    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133689.1-1134s21c1
Sequence:CCGGACCAAGGGTACTTCGAGAATACTCGAGTATTCTCGAAGTACCCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133689.1-313s21c1
Sequence:CCGGTCCTGCCATAGGGCAACAAATCTCGAGATTTGTTGCCCTATGGCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133689.1-249s21c1
Sequence:CCGGCAGGCTACAAATCCAACTATCCTCGAGGATAGTTGGATTTGTAGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133689
PPP1R32 MISSION shRNA shRNA Plasmid DNA
protein phosphatase 1, regulatory subunit 32
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000198484    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133689.1-802s1c1
Sequence:CCGGGAGTATCACCAAGTCAGACTACTCGAGTAGTCTGACTTGGTGATACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181919    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133689.1-901s1c1
Sequence:CCGGCCGAGTGAATGAAAGGACCTTCTCGAGAAGGTCCTTTCATTCACTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177897    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133689.1-1051s1c1
Sequence:CCGGCACAGGGTTCACTCTTAACAACTCGAGTTGTTAAGAGTGAACCCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133689.1-377s21c1
Sequence:CCGGCTAGAAGTGCCCGATGGTAAACTCGAGTTTACCATCGGGCACTTCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264376    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133689.1-1134s21c1
Sequence:CCGGACCAAGGGTACTTCGAGAATACTCGAGTATTCTCGAAGTACCCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133689.1-313s21c1
Sequence:CCGGTCCTGCCATAGGGCAACAAATCTCGAGATTTGTTGCCCTATGGCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133689.1-249s21c1
Sequence:CCGGCAGGCTACAAATCCAACTATCCTCGAGGATAGTTGGATTTGTAGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133689
PPP1R32 MISSION shRNA Lentiviral Transduction Particles
protein phosphatase 1, regulatory subunit 32
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000198484    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133689.1-802s1c1
Sequence:CCGGGAGTATCACCAAGTCAGACTACTCGAGTAGTCTGACTTGGTGATACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181919    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133689.1-901s1c1
Sequence:CCGGCCGAGTGAATGAAAGGACCTTCTCGAGAAGGTCCTTTCATTCACTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177897    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133689.1-1051s1c1
Sequence:CCGGCACAGGGTTCACTCTTAACAACTCGAGTTGTTAAGAGTGAACCCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133689.1-377s21c1
Sequence:CCGGCTAGAAGTGCCCGATGGTAAACTCGAGTTTACCATCGGGCACTTCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264376    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133689.1-1134s21c1
Sequence:CCGGACCAAGGGTACTTCGAGAATACTCGAGTATTCTCGAAGTACCCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133689.1-313s21c1
Sequence:CCGGTCCTGCCATAGGGCAACAAATCTCGAGATTTGTTGCCCTATGGCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133689.1-249s21c1
Sequence:CCGGCAGGCTACAAATCCAACTATCCTCGAGGATAGTTGGATTTGTAGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks