EMAIL THIS PAGE TO A FRIEND

PPP1R3C

protein phosphatase 1, regulatory subunit 3C

Synonyms: PPP1R5
UniProtKB ID: Q9UQK1, B2R7X0, O95686
Gene ID:
Human(5507) Summary: This gene encodes a regulatory subunit of protein phosphatase-1 (PP1). PP1 catalyzes reversible protein phosphorylation, which is important in a wide range of cellular activities: neuronal, muscular, RNA splicing, protein synthesis, cell death, and glycogen metabolism, to name just a few. By interacting with different regulatory subunits, PP1 is directed to different parts of the cell, to different substrates, or to respond to extracellular signals. [provided by RefSeq, Oct 2011]
Mouse(53412) protein phosphatase 1, regulatory (inhibitor) subunit 3C
Rat(309513) protein phosphatase 1, regulatory subunit 3C
cow(539466) protein phosphatase 1, regulatory subunit 3C
sheep(101123512) protein phosphatase 1, regulatory subunit 3C
domestic guinea pig(100733645) protein phosphatase 1, regulatory subunit 3C
naked mole-rat(101722711) protein phosphatase 1, regulatory subunit 3C
chicken(425328) protein phosphatase 1, regulatory subunit 3C
dog(477766) protein phosphatase 1, regulatory subunit 3C
domestic cat(101084485) protein phosphatase 1, regulatory subunit 3C
166 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005398 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005398 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005398 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_016854 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016854 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016854 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005398 siRNAs that have been validated in the lab human pricing
NM_001012072 Rosetta Predictions rat pricing
XM_574659 Rosetta Predictions rat pricing
NM_016854 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005398 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00023834 validated 1062
1 SASI_Hs01_00023833 validated 373
1 SASI_Hs01_00023835 validated 874
2 SASI_Hs02_00339525 predicted 979
3 SASI_Hs01_00023836 predicted 769
4 SASI_Hs01_00023838 predicted 1163
5 SASI_Hs01_00023839 predicted 257
6 SASI_Hs01_00023840 predicted 667
7 SASI_Hs01_00023841 predicted 723
8 SASI_Hs01_00023842 predicted 984
9 SASI_Hs01_00023837 predicted 497
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012072 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00200183 predicted 751
2 SASI_Rn01_00089601 predicted 502
3 SASI_Rn01_00089602 predicted 687
4 SASI_Rn01_00089604 predicted 1016
5 SASI_Rn01_00089606 predicted 1031
6 SASI_Rn01_00089607 predicted 838
7 SASI_Rn01_00089608 predicted 569
8 SASI_Rn01_00089609 predicted 1044
9 SASI_Rn01_00089610 predicted 837
10 SASI_Rn02_00200184 predicted 293
11 SASI_Rn01_00089603 predicted 327
12 SASI_Rn01_00089605 predicted 431
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_574659 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00189827 predicted 444
2 SASI_Rn01_00189828 predicted 462
3 SASI_Rn01_00189829 predicted 691
4 SASI_Rn01_00189830 predicted 617
5 SASI_Rn01_00189831 predicted 637
6 SASI_Rn01_00189832 predicted 520
7 SASI_Rn01_00189833 predicted 525
8 SASI_Rn01_00189834 predicted 792
9 SASI_Rn01_00189835 predicted 752
10 SASI_Rn01_00189836 predicted 614
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016854 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00087440 predicted 1031
2 SASI_Mm01_00087441 predicted 1006
3 SASI_Mm02_00323632 predicted 1073
4 SASI_Mm01_00087443 predicted 1041
5 SASI_Mm01_00087445 predicted 270
6 SASI_Mm01_00087446 predicted 961
7 SASI_Mm01_00087447 predicted 977
8 SASI_Mm01_00087448 predicted 389
9 SASI_Mm02_00323633 predicted 1036
10 SASI_Mm01_00087449 predicted 1069
11 SASI_Mm01_00087442 predicted 1132
12 SASI_Mm01_00087444 predicted 257
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005398
VALIDATED
PPP1R3C MISSION shRNA Bacterial Glycerol Stock
protein phosphatase 1, regulatory subunit 3C
Human
16 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000381262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005398.4-581s21c1
Sequence:GTACCGGGCCACTTTCAGAAGAACTTTGCTCGAGCAAAGTTCTTCTGAAAGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005398.4-767s21c1
Sequence:GTACCGGATAGTGATACCTTCTCATTTGCTCGAGCAAATGAGAAGGTATCACTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380205    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005398.4-619s21c1
Sequence:GTACCGGTCGTTGCAAGAGCGAACAGTGCTCGAGCACTGTTCGCTCTTGCAACGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005398.4-210s21c1
Sequence:GTACCGGGAGGCTTTGCTTGGCACATTCCTCGAGGAATGTGCCAAGCAAAGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005398.4-374s21c1
Sequence:GTACCGGCCAAGAAGCGCGTTGTGTTTGCTCGAGCAAACACAACGCGCTTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218115    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_005398.4-551s21c1
Sequence:GTACCGGAGCCTTCAACCGATTACTTAACTCGAGTTAAGTAATCGGTTGAAGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218930    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005398.4-472s21c1
Sequence:GTACCGGTTTGATCTCTTGGACCTTAATCTCGAGATTAAGGTCCAAGAGATCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230769    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_005398.4-1681s21c1
Sequence:CCGGTCCGGAGAATCAAGATCTTAACTCGAGTTAAGATCTTGATTCTCCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230768    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_005398.4-986s21c1
Sequence:CCGGAGTTAGAGTCAACAATCTTTGCTCGAGCAAAGATTGTTGACTCTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_005398.4-264s21c1
Sequence:CCGGTGAATTTCAACGACGACATTTCTCGAGAAATGTCGTCGTTGAAATTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380244    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005398.4-1080s21c1
Sequence:GTACCGGTCGATGAATTAAGCAACAATGCTCGAGCATTGTTGCTTAATTCATCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380506    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005398.4-1260s21c1
Sequence:GTACCGGCAGATGATGCTACCCAATTTGCTCGAGCAAATTGGGTAGCATCATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002533    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_005398.x-396s1c1
Sequence:CCGGGTTTGATCTCTTGGACCTTAACTCGAGTTAAGGTCCAAGAGATCAAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002536    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005398.x-1279s1c1
Sequence:CCGGCCCTCTCAATCCACTAGCTTTCTCGAGAAAGCTAGTGGATTGAGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005398.x-474s1c1
Sequence:CCGGTCAGCCTTCAACCGATTACTTCTCGAGAAGTAATCGGTTGAAGGCTGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002535    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_005398.x-253s1c1
Sequence:CCGGCACAAAGCCAAATCACAGAATCTCGAGATTCTGTGATTTGGCTTTGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005398
VALIDATED
PPP1R3C MISSION shRNA shRNA Plasmid DNA
protein phosphatase 1, regulatory subunit 3C
Human
16 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000381262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005398.4-581s21c1
Sequence:GTACCGGGCCACTTTCAGAAGAACTTTGCTCGAGCAAAGTTCTTCTGAAAGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005398.4-767s21c1
Sequence:GTACCGGATAGTGATACCTTCTCATTTGCTCGAGCAAATGAGAAGGTATCACTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380205    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005398.4-619s21c1
Sequence:GTACCGGTCGTTGCAAGAGCGAACAGTGCTCGAGCACTGTTCGCTCTTGCAACGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005398.4-210s21c1
Sequence:GTACCGGGAGGCTTTGCTTGGCACATTCCTCGAGGAATGTGCCAAGCAAAGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005398.4-374s21c1
Sequence:GTACCGGCCAAGAAGCGCGTTGTGTTTGCTCGAGCAAACACAACGCGCTTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218115    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_005398.4-551s21c1
Sequence:GTACCGGAGCCTTCAACCGATTACTTAACTCGAGTTAAGTAATCGGTTGAAGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218930    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005398.4-472s21c1
Sequence:GTACCGGTTTGATCTCTTGGACCTTAATCTCGAGATTAAGGTCCAAGAGATCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230769    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_005398.4-1681s21c1
Sequence:CCGGTCCGGAGAATCAAGATCTTAACTCGAGTTAAGATCTTGATTCTCCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230768    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_005398.4-986s21c1
Sequence:CCGGAGTTAGAGTCAACAATCTTTGCTCGAGCAAAGATTGTTGACTCTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_005398.4-264s21c1
Sequence:CCGGTGAATTTCAACGACGACATTTCTCGAGAAATGTCGTCGTTGAAATTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380244    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005398.4-1080s21c1
Sequence:GTACCGGTCGATGAATTAAGCAACAATGCTCGAGCATTGTTGCTTAATTCATCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380506    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005398.4-1260s21c1
Sequence:GTACCGGCAGATGATGCTACCCAATTTGCTCGAGCAAATTGGGTAGCATCATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002533    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_005398.x-396s1c1
Sequence:CCGGGTTTGATCTCTTGGACCTTAACTCGAGTTAAGGTCCAAGAGATCAAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002536    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005398.x-1279s1c1
Sequence:CCGGCCCTCTCAATCCACTAGCTTTCTCGAGAAAGCTAGTGGATTGAGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005398.x-474s1c1
Sequence:CCGGTCAGCCTTCAACCGATTACTTCTCGAGAAGTAATCGGTTGAAGGCTGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002535    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_005398.x-253s1c1
Sequence:CCGGCACAAAGCCAAATCACAGAATCTCGAGATTCTGTGATTTGGCTTTGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005398
VALIDATED
PPP1R3C MISSION shRNA Lentiviral Transduction Particles
protein phosphatase 1, regulatory subunit 3C
Human
16 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000381262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005398.4-581s21c1
Sequence:GTACCGGGCCACTTTCAGAAGAACTTTGCTCGAGCAAAGTTCTTCTGAAAGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005398.4-767s21c1
Sequence:GTACCGGATAGTGATACCTTCTCATTTGCTCGAGCAAATGAGAAGGTATCACTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380205    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005398.4-619s21c1
Sequence:GTACCGGTCGTTGCAAGAGCGAACAGTGCTCGAGCACTGTTCGCTCTTGCAACGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005398.4-210s21c1
Sequence:GTACCGGGAGGCTTTGCTTGGCACATTCCTCGAGGAATGTGCCAAGCAAAGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005398.4-374s21c1
Sequence:GTACCGGCCAAGAAGCGCGTTGTGTTTGCTCGAGCAAACACAACGCGCTTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218115    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_005398.4-551s21c1
Sequence:GTACCGGAGCCTTCAACCGATTACTTAACTCGAGTTAAGTAATCGGTTGAAGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218930    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005398.4-472s21c1
Sequence:GTACCGGTTTGATCTCTTGGACCTTAATCTCGAGATTAAGGTCCAAGAGATCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230769    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_005398.4-1681s21c1
Sequence:CCGGTCCGGAGAATCAAGATCTTAACTCGAGTTAAGATCTTGATTCTCCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230768    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_005398.4-986s21c1
Sequence:CCGGAGTTAGAGTCAACAATCTTTGCTCGAGCAAAGATTGTTGACTCTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_005398.4-264s21c1
Sequence:CCGGTGAATTTCAACGACGACATTTCTCGAGAAATGTCGTCGTTGAAATTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380244    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005398.4-1080s21c1
Sequence:GTACCGGTCGATGAATTAAGCAACAATGCTCGAGCATTGTTGCTTAATTCATCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380506    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005398.4-1260s21c1
Sequence:GTACCGGCAGATGATGCTACCCAATTTGCTCGAGCAAATTGGGTAGCATCATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002533    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_005398.x-396s1c1
Sequence:CCGGGTTTGATCTCTTGGACCTTAACTCGAGTTAAGGTCCAAGAGATCAAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002536    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005398.x-1279s1c1
Sequence:CCGGCCCTCTCAATCCACTAGCTTTCTCGAGAAAGCTAGTGGATTGAGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005398.x-474s1c1
Sequence:CCGGTCAGCCTTCAACCGATTACTTCTCGAGAAGTAATCGGTTGAAGGCTGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002535    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_005398.x-253s1c1
Sequence:CCGGCACAAAGCCAAATCACAGAATCTCGAGATTCTGTGATTTGGCTTTGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016854
VALIDATED
PPP1R3C MISSION shRNA Bacterial Glycerol Stock
protein phosphatase 1, regulatory subunit 3C
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000327969    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016854.2-741s21c1
Sequence:CCGGTGCATTTCTTATCACGCTAATCTCGAGATTAGCGTGATAAGAAATGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327968    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016854.2-977s21c1
Sequence:CCGGGACCTCCTATCGATGAGTTAGCTCGAGCTAACTCATCGATAGGAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327967    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016854.2-1390s21c1
Sequence:CCGGGCCATGGTTAAGTGGATATTACTCGAGTAATATCCACTTAACCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016854.2-378s21c1
Sequence:CCGGTTTGATCTCTTGGACCTTAACCTCGAGGTTAAGGTCCAAGAGATCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016854.2-457s21c1
Sequence:CCGGAGCCCTCAACCGACTACTTAACTCGAGTTAAGTAGTCGGTTGAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016854.1-732s1c1
Sequence:CCGGCTTCTCCTTTGCCATCGACTTCTCGAGAAGTCGATGGCAAAGGAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176771    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016854.1-1122s1c1
Sequence:CCGGCGTAGTTACTTTCTATCAGTACTCGAGTACTGATAGAAAGTAACTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016854.1-606s1c1
Sequence:CCGGGAAAGTGAAGAATGTGAGCTTCTCGAGAAGCTCACATTCTTCACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016854.1-1015s1c1
Sequence:CCGGGTGGAGAACTTGACCTCCTATCTCGAGATAGGAGGTCAAGTTCTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016854
VALIDATED
PPP1R3C MISSION shRNA shRNA Plasmid DNA
protein phosphatase 1, regulatory subunit 3C
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000327969    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016854.2-741s21c1
Sequence:CCGGTGCATTTCTTATCACGCTAATCTCGAGATTAGCGTGATAAGAAATGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327968    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016854.2-977s21c1
Sequence:CCGGGACCTCCTATCGATGAGTTAGCTCGAGCTAACTCATCGATAGGAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327967    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016854.2-1390s21c1
Sequence:CCGGGCCATGGTTAAGTGGATATTACTCGAGTAATATCCACTTAACCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016854.2-378s21c1
Sequence:CCGGTTTGATCTCTTGGACCTTAACCTCGAGGTTAAGGTCCAAGAGATCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016854.2-457s21c1
Sequence:CCGGAGCCCTCAACCGACTACTTAACTCGAGTTAAGTAGTCGGTTGAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016854.1-732s1c1
Sequence:CCGGCTTCTCCTTTGCCATCGACTTCTCGAGAAGTCGATGGCAAAGGAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176771    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016854.1-1122s1c1
Sequence:CCGGCGTAGTTACTTTCTATCAGTACTCGAGTACTGATAGAAAGTAACTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016854.1-606s1c1
Sequence:CCGGGAAAGTGAAGAATGTGAGCTTCTCGAGAAGCTCACATTCTTCACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016854.1-1015s1c1
Sequence:CCGGGTGGAGAACTTGACCTCCTATCTCGAGATAGGAGGTCAAGTTCTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016854
VALIDATED
PPP1R3C MISSION shRNA Lentiviral Transduction Particles
protein phosphatase 1, regulatory subunit 3C
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000327969    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016854.2-741s21c1
Sequence:CCGGTGCATTTCTTATCACGCTAATCTCGAGATTAGCGTGATAAGAAATGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327968    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016854.2-977s21c1
Sequence:CCGGGACCTCCTATCGATGAGTTAGCTCGAGCTAACTCATCGATAGGAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327967    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016854.2-1390s21c1
Sequence:CCGGGCCATGGTTAAGTGGATATTACTCGAGTAATATCCACTTAACCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016854.2-378s21c1
Sequence:CCGGTTTGATCTCTTGGACCTTAACCTCGAGGTTAAGGTCCAAGAGATCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016854.2-457s21c1
Sequence:CCGGAGCCCTCAACCGACTACTTAACTCGAGTTAAGTAGTCGGTTGAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016854.1-732s1c1
Sequence:CCGGCTTCTCCTTTGCCATCGACTTCTCGAGAAGTCGATGGCAAAGGAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176771    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016854.1-1122s1c1
Sequence:CCGGCGTAGTTACTTTCTATCAGTACTCGAGTACTGATAGAAAGTAACTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016854.1-606s1c1
Sequence:CCGGGAAAGTGAAGAATGTGAGCTTCTCGAGAAGCTCACATTCTTCACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016854.1-1015s1c1
Sequence:CCGGGTGGAGAACTTGACCTCCTATCTCGAGATAGGAGGTCAAGTTCTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks