EMAIL THIS PAGE TO A FRIEND

PPP2R2B

protein phosphatase 2, regulatory subunit B, beta

Synonyms: B55BETA PP2AB55BETA PP2ABBETA PP2APR55B PP2APR55BETA PR2AB55BETA PR2ABBETA PR2APR55BETA PR52B PR55-BETA PR55BETA SCA12
Gene ID:
Human(5521) Summary: The product of this gene belongs to the phosphatase 2 regulatory subunit B family. Protein phosphatase 2 is one of the four major Ser/Thr phosphatases, and it is implicated in the negative control of cell growth and division. It consists of a common heteromeric core enzyme, which is composed of a catalytic subunit and a constant regulatory subunit, that associates with a variety of regulatory subunits. The B regulatory subunit might modulate substrate selectivity and catalytic activity. This gene encodes a beta isoform of the regulatory subunit B55 subfamily. Defects in this gene cause autosomal dominant spinocerebellar ataxia 12 (SCA12), a disease caused by degeneration of the cerebellum, sometimes involving the brainstem and spinal cord, and in resulting in poor coordination of speech and body movements. Multiple alternatively spliced variants, which encode different isoforms, have been identified for this gene. The 5' UTR of some of these variants includes a CAG trinucleotide repeat sequence (7-28 copies) that can be expanded to 66-78 copies in cases of SCA12. [provided by RefSeq, Jul 2008]
Mouse(72930) protein phosphatase 2 (formerly 2A), regulatory subunit B (PR 52), beta isoform
Rat(60660) protein phosphatase 2, regulatory subunit B, beta
cow(509290) protein phosphatase 2, regulatory subunit B, beta
sheep(101113409) protein phosphatase 2, regulatory subunit B, beta
domestic guinea pig(100716856) protein phosphatase 2, regulatory subunit B, beta
naked mole-rat(101700573) protein phosphatase 2, regulatory subunit B, beta
Domestic Rabbit(100009139) protein phosphatase 2, regulatory subunit B, beta
chicken(416350) protein phosphatase 2, regulatory subunit B, beta
domestic cat(101084083) protein phosphatase 2, regulatory subunit B, beta
Horse(100060957) protein phosphatase 2, regulatory subunit B, beta
dog(478053) protein phosphatase 2, regulatory subunit B, beta
168 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
C7632 Cantharidin human pricing
D6908 DL-erythro-Dihydrosphingosine ≥99%, synthetic human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_028392 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028392 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028392 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004576 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004576 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004576 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU079041 MISSION® esiRNA esiRNA human PPP2R2B (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001127381 Rosetta Predictions human pricing
NM_004576 Rosetta Predictions human pricing
NM_181674 Rosetta Predictions human pricing
NM_181675 Rosetta Predictions human pricing
NM_181676 Rosetta Predictions human pricing
NM_181677 Rosetta Predictions human pricing
NM_181678 Rosetta Predictions human pricing
NM_022209 Rosetta Predictions rat pricing
NM_027531 Rosetta Predictions mouse pricing
NM_028392 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127381 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00329304 predicted 1683
2 SASI_Hs02_00329305 predicted 1673
3 SASI_Hs02_00329306 predicted 1601
4 SASI_Hs02_00329307 predicted 900
5 SASI_Hs02_00329308 predicted 1270
6 SASI_Hs02_00329309 predicted 1161
7 SASI_Hs02_00329310 predicted 618
8 SASI_Hs02_00329311 predicted 1732
9 SASI_Hs02_00329312 predicted 812
10 SASI_Hs02_00329313 predicted 668
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004576 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00032759 predicted 1891
2 SASI_Hs02_00337913 predicted 1884
3 SASI_Hs01_00032760 predicted 1806
4 SASI_Hs01_00032761 predicted 1107
5 SASI_Hs01_00032762 predicted 1471
6 SASI_Hs01_00032763 predicted 1361
7 SASI_Hs01_00032764 predicted 831
8 SASI_Hs01_00032765 predicted 1937
9 SASI_Hs01_00032767 predicted 1021
10 SASI_Hs01_00032768 predicted 874
11 SASI_Hs01_00032766 predicted 1833
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181674 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00040339 predicted 1963
2 SASI_Hs02_00370269 predicted 1953
3 SASI_Hs01_00040340 predicted 1878
4 SASI_Hs01_00040341 predicted 1179
5 SASI_Hs01_00040342 predicted 1546
6 SASI_Hs01_00040343 predicted 1435
7 SASI_Hs01_00040344 predicted 906
8 SASI_Hs01_00040345 predicted 2011
9 SASI_Hs01_00040347 predicted 1091
10 SASI_Hs01_00040348 predicted 942
11 SASI_Hs01_00040346 predicted 1787
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181675 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00112704 predicted 1660
2 SASI_Hs02_00370270 predicted 1655
3 SASI_Hs01_00112705 predicted 1585
4 SASI_Hs01_00112706 predicted 874
5 SASI_Hs01_00112707 predicted 1248
6 SASI_Hs01_00112708 predicted 1134
7 SASI_Hs01_00112709 predicted 598
8 SASI_Hs01_00112710 predicted 1715
9 SASI_Hs01_00112712 predicted 790
10 SASI_Hs01_00112713 predicted 650
11 SASI_Hs01_00112711 predicted 1581
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181676 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00164594 predicted 1762
2 SASI_Hs02_00370271 predicted 1759
3 SASI_Hs01_00164595 predicted 1692
4 SASI_Hs01_00164596 predicted 977
5 SASI_Hs01_00164597 predicted 1350
6 SASI_Hs01_00164598 predicted 1246
7 SASI_Hs01_00164599 predicted 712
8 SASI_Hs01_00164600 predicted 1820
9 SASI_Hs01_00164602 predicted 893
10 SASI_Hs01_00164603 predicted 750
11 SASI_Hs01_00164601 predicted 1489
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181677 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00030683 predicted 1586
2 SASI_Hs02_00370272 predicted 1586
3 SASI_Hs01_00030684 predicted 1514
4 SASI_Hs01_00030685 predicted 811
5 SASI_Hs01_00030686 predicted 1176
6 SASI_Hs01_00030687 predicted 1067
7 SASI_Hs01_00030688 predicted 531
8 SASI_Hs01_00030689 predicted 1643
9 SASI_Hs01_00030691 predicted 716
10 SASI_Hs01_00030692 predicted 579
11 SASI_Hs01_00030690 predicted 1508
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181678 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00065490 predicted 1601
2 SASI_Hs02_00370273 predicted 1602
3 SASI_Hs01_00065491 predicted 1525
4 SASI_Hs01_00065492 predicted 816
5 SASI_Hs01_00065493 predicted 1191
6 SASI_Hs01_00065494 predicted 1085
7 SASI_Hs01_00065495 predicted 548
8 SASI_Hs01_00065496 predicted 1657
9 SASI_Hs01_00065498 predicted 734
10 SASI_Hs01_00065499 predicted 592
11 SASI_Hs01_00065497 predicted 1527
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022209 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00262967 predicted 1520
2 SASI_Rn01_00114169 predicted 508
3 SASI_Rn01_00114170 predicted 1495
4 SASI_Rn01_00114171 predicted 688
5 SASI_Rn01_00114172 predicted 1100
6 SASI_Rn01_00114173 predicted 1499
7 SASI_Rn01_00114174 predicted 736
8 SASI_Rn01_00114175 predicted 1397
9 SASI_Rn01_00114177 predicted 988
10 SASI_Rn01_00114178 predicted 987
11 SASI_Rn01_00114176 predicted 230
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027531 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00071941 predicted 506
2 SASI_Mm01_00071942 predicted 520
3 SASI_Mm01_00071943 predicted 768
4 SASI_Mm01_00071944 predicted 667
5 SASI_Mm01_00071945 predicted 704
6 SASI_Mm01_00071946 predicted 1126
7 SASI_Mm01_00071947 predicted 1153
8 SASI_Mm01_00071948 predicted 1013
9 SASI_Mm01_00071949 predicted 1464
10 SASI_Mm01_00071950 predicted 1111
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028392 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00090184 predicted 577
2 SASI_Mm01_00090185 predicted 585
3 SASI_Mm01_00090186 predicted 831
4 SASI_Mm01_00090187 predicted 732
5 SASI_Mm01_00090188 predicted 772
6 SASI_Mm01_00090189 predicted 1187
7 SASI_Mm01_00090190 predicted 1214
8 SASI_Mm01_00090191 predicted 1082
9 SASI_Mm01_00090192 predicted 1531
10 SASI_Mm01_00090193 predicted 1182
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028392
PPP2R2B MISSION shRNA Bacterial Glycerol Stock
protein phosphatase 2, regulatory subunit B, beta
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000441014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028392.2-594s21c1
Sequence:CCGGGAAAGTCAGTGAGCGGGATAACTCGAGTTATCCCGCTCACTGACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028392.2-1454s21c1
Sequence:CCGGGTGTTGACAGTCTGGACTTTACTCGAGTAAAGTCCAGACTGTCAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071488    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028392.1-1583s1c1
Sequence:CCGGGCTACTACTTAGTCTCACATACTCGAGTATGTGAGACTAAGTAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028392.1-301s1c1
Sequence:CCGGGCCATACTGAAGCTGACATTACTCGAGTAATGTCAGCTTCAGTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028392.1-1530s1c1
Sequence:CCGGGCGGCTACGAATAACTTATATCTCGAGATATAAGTTATTCGTAGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028392.1-941s1c1
Sequence:CCGGCCACTGCAACACCTTCGTATACTCGAGTATACGAAGGTGTTGCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028392.1-474s1c1
Sequence:CCGGCCCGAGTTCGATTACCTGAAACTCGAGTTTCAGGTAATCGAACTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028392
PPP2R2B MISSION shRNA shRNA Plasmid DNA
protein phosphatase 2, regulatory subunit B, beta
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000441014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028392.2-594s21c1
Sequence:CCGGGAAAGTCAGTGAGCGGGATAACTCGAGTTATCCCGCTCACTGACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028392.2-1454s21c1
Sequence:CCGGGTGTTGACAGTCTGGACTTTACTCGAGTAAAGTCCAGACTGTCAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071488    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028392.1-1583s1c1
Sequence:CCGGGCTACTACTTAGTCTCACATACTCGAGTATGTGAGACTAAGTAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028392.1-301s1c1
Sequence:CCGGGCCATACTGAAGCTGACATTACTCGAGTAATGTCAGCTTCAGTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028392.1-1530s1c1
Sequence:CCGGGCGGCTACGAATAACTTATATCTCGAGATATAAGTTATTCGTAGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028392.1-941s1c1
Sequence:CCGGCCACTGCAACACCTTCGTATACTCGAGTATACGAAGGTGTTGCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028392.1-474s1c1
Sequence:CCGGCCCGAGTTCGATTACCTGAAACTCGAGTTTCAGGTAATCGAACTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028392
PPP2R2B MISSION shRNA Lentiviral Transduction Particles
protein phosphatase 2, regulatory subunit B, beta
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000441014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028392.2-594s21c1
Sequence:CCGGGAAAGTCAGTGAGCGGGATAACTCGAGTTATCCCGCTCACTGACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028392.2-1454s21c1
Sequence:CCGGGTGTTGACAGTCTGGACTTTACTCGAGTAAAGTCCAGACTGTCAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071488    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028392.1-1583s1c1
Sequence:CCGGGCTACTACTTAGTCTCACATACTCGAGTATGTGAGACTAAGTAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028392.1-301s1c1
Sequence:CCGGGCCATACTGAAGCTGACATTACTCGAGTAATGTCAGCTTCAGTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028392.1-1530s1c1
Sequence:CCGGGCGGCTACGAATAACTTATATCTCGAGATATAAGTTATTCGTAGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028392.1-941s1c1
Sequence:CCGGCCACTGCAACACCTTCGTATACTCGAGTATACGAAGGTGTTGCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028392.1-474s1c1
Sequence:CCGGCCCGAGTTCGATTACCTGAAACTCGAGTTTCAGGTAATCGAACTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004576
VALIDATED
PPP2R2B MISSION shRNA Bacterial Glycerol Stock
protein phosphatase 2, regulatory subunit B, beta
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000294422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004576.2-598s21c1
Sequence:CCGGGACATTATCTCTACGGTAGAACTCGAGTTCTACCGTAGAGATAATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294476    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004576.2-1878s21c1
Sequence:CCGGTAATCTCACATACTGAATACTCTCGAGAGTATTCAGTATGTGAGATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000307348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004576.2-1360s21c1
Sequence:CCGGGAAATTATCTCTTCGATTTCGCTCGAGCGAAATCGAAGAGATAATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010506    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004576.x-2424s1c1
Sequence:CCGGAGAAGAGGATGCAGAATGACCTCGAGGTCATTCTGCATCCTCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A3
TRC Version: 1 Clone ID:NM_004576.x-1360s1c1
Sequence:CCGGAAATTATCTCTTCGATTTCGCTCGAGCGAAATCGAAGAGATAATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009862    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A3
TRC Version: 1 Clone ID:NM_004576.x-1878s1c1
Sequence:CCGGTAATCTCACATACTGAATACTCTCGAGAGTATTCAGTATGTGAGATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A3
TRC Version: 1 Clone ID:NM_004576.x-598s1c1
Sequence:CCGGACATTATCTCTACGGTAGAACTCGAGTTCTACCGTAGAGATAATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040168    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004576.2-2083s1c1
Sequence:CCGGGCTAACAGTAATTCTTCCATACTCGAGTATGGAAGAATTACTGTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004576.2-595s1c1
Sequence:CCGGGCTGACATTATCTCTACGGTACTCGAGTACCGTAGAGATAATGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A3
TRC Version: 1 Clone ID:NM_004576.2-836s1c1
Sequence:CCGGCTTACTTTCTTCTGTCTACTACTCGAGTAGTAGACAGAAGAAAGTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040171    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A3
TRC Version: 1 Clone ID:NM_004576.2-1035s1c1
Sequence:CCGGCGCACACACATATCACATCAACTCGAGTTGATGTGATATGTGTGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A3
TRC Version: 1 Clone ID:NM_004576.2-1813s1c1
Sequence:CCGGGCGGCTACAAATAACCTATATCTCGAGATATAGGTTATTTGTAGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004576
VALIDATED
PPP2R2B MISSION shRNA shRNA Plasmid DNA
protein phosphatase 2, regulatory subunit B, beta
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000294422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004576.2-598s21c1
Sequence:CCGGGACATTATCTCTACGGTAGAACTCGAGTTCTACCGTAGAGATAATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294476    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004576.2-1878s21c1
Sequence:CCGGTAATCTCACATACTGAATACTCTCGAGAGTATTCAGTATGTGAGATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000307348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004576.2-1360s21c1
Sequence:CCGGGAAATTATCTCTTCGATTTCGCTCGAGCGAAATCGAAGAGATAATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010506    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004576.x-2424s1c1
Sequence:CCGGAGAAGAGGATGCAGAATGACCTCGAGGTCATTCTGCATCCTCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A3
TRC Version: 1 Clone ID:NM_004576.x-1360s1c1
Sequence:CCGGAAATTATCTCTTCGATTTCGCTCGAGCGAAATCGAAGAGATAATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009862    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A3
TRC Version: 1 Clone ID:NM_004576.x-1878s1c1
Sequence:CCGGTAATCTCACATACTGAATACTCTCGAGAGTATTCAGTATGTGAGATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A3
TRC Version: 1 Clone ID:NM_004576.x-598s1c1
Sequence:CCGGACATTATCTCTACGGTAGAACTCGAGTTCTACCGTAGAGATAATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040168    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004576.2-2083s1c1
Sequence:CCGGGCTAACAGTAATTCTTCCATACTCGAGTATGGAAGAATTACTGTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004576.2-595s1c1
Sequence:CCGGGCTGACATTATCTCTACGGTACTCGAGTACCGTAGAGATAATGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A3
TRC Version: 1 Clone ID:NM_004576.2-836s1c1
Sequence:CCGGCTTACTTTCTTCTGTCTACTACTCGAGTAGTAGACAGAAGAAAGTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040171    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A3
TRC Version: 1 Clone ID:NM_004576.2-1035s1c1
Sequence:CCGGCGCACACACATATCACATCAACTCGAGTTGATGTGATATGTGTGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A3
TRC Version: 1 Clone ID:NM_004576.2-1813s1c1
Sequence:CCGGGCGGCTACAAATAACCTATATCTCGAGATATAGGTTATTTGTAGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004576
VALIDATED
PPP2R2B MISSION shRNA Lentiviral Transduction Particles
protein phosphatase 2, regulatory subunit B, beta
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000294422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004576.2-598s21c1
Sequence:CCGGGACATTATCTCTACGGTAGAACTCGAGTTCTACCGTAGAGATAATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294476    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004576.2-1878s21c1
Sequence:CCGGTAATCTCACATACTGAATACTCTCGAGAGTATTCAGTATGTGAGATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000307348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004576.2-1360s21c1
Sequence:CCGGGAAATTATCTCTTCGATTTCGCTCGAGCGAAATCGAAGAGATAATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010506    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004576.x-2424s1c1
Sequence:CCGGAGAAGAGGATGCAGAATGACCTCGAGGTCATTCTGCATCCTCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A3
TRC Version: 1 Clone ID:NM_004576.x-1360s1c1
Sequence:CCGGAAATTATCTCTTCGATTTCGCTCGAGCGAAATCGAAGAGATAATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009862    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A3
TRC Version: 1 Clone ID:NM_004576.x-1878s1c1
Sequence:CCGGTAATCTCACATACTGAATACTCTCGAGAGTATTCAGTATGTGAGATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A3
TRC Version: 1 Clone ID:NM_004576.x-598s1c1
Sequence:CCGGACATTATCTCTACGGTAGAACTCGAGTTCTACCGTAGAGATAATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040168    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004576.2-2083s1c1
Sequence:CCGGGCTAACAGTAATTCTTCCATACTCGAGTATGGAAGAATTACTGTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004576.2-595s1c1
Sequence:CCGGGCTGACATTATCTCTACGGTACTCGAGTACCGTAGAGATAATGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A3
TRC Version: 1 Clone ID:NM_004576.2-836s1c1
Sequence:CCGGCTTACTTTCTTCTGTCTACTACTCGAGTAGTAGACAGAAGAAAGTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040171    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A3
TRC Version: 1 Clone ID:NM_004576.2-1035s1c1
Sequence:CCGGCGCACACACATATCACATCAACTCGAGTTGATGTGATATGTGTGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A3
TRC Version: 1 Clone ID:NM_004576.2-1813s1c1
Sequence:CCGGGCGGCTACAAATAACCTATATCTCGAGATATAGGTTATTTGTAGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks