EMAIL THIS PAGE TO A FRIEND

PPP2R5C

protein phosphatase 2, regulatory subunit B', gamma

Synonyms: B56G PR61G
Gene ID:
Human(5527) Summary: The product of this gene belongs to the phosphatase 2A regulatory subunit B family. Protein phosphatase 2A is one of the four major Ser/Thr phosphatases, and it is implicated in the negative control of cell growth and division. It consists of a common heteromeric core enzyme, which is composed of a catalytic subunit and a constant regulatory subunit, that associates with a variety of regulatory subunits. The B regulatory subunit might modulate substrate selectivity and catalytic activity. This gene encodes a gamma isoform of the regulatory subunit B56 subfamily. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
Mouse(26931) protein phosphatase 2, regulatory subunit B (B56), gamma isoform
Rat(691318) protein phosphatase 2, regulatory subunit B', gamma
Zebrafish(100005981) protein phosphatase 2, regulatory subunit B', gamma
Horse(100054977) protein phosphatase 2, regulatory subunit B', gamma
dog(480436) protein phosphatase 2, regulatory subunit B', gamma
chicken(423460) protein phosphatase 2, regulatory subunit B', gamma
domestic cat(101094427) protein phosphatase 2, regulatory subunit B', gamma
naked mole-rat(101726315) protein phosphatase 2, regulatory subunit B', gamma
Domestic Rabbit(100009216) protein phosphatase 2, regulatory subunit B', gamma
domestic guinea pig(100732627) protein phosphatase 2, regulatory subunit B', gamma
cow(505757) protein phosphatase 2, regulatory subunit B', gamma
sheep(101102015) protein phosphatase 2, regulatory subunit B', gamma
258 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002719 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002719 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002719 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_012023 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_012023 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_012023 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002719 Rosetta Predictions human pricing
NM_178586 Rosetta Predictions human pricing
NM_178587 Rosetta Predictions human pricing
NM_178588 Rosetta Predictions human pricing
XM_001077680 Rosetta Predictions rat pricing
NM_001081457 Rosetta Predictions mouse pricing
NM_001081458 Rosetta Predictions mouse pricing
NM_012023 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002719 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00084059 predicted 321
2 SASI_Hs02_00334312 predicted 392
3 SASI_Hs01_00084060 predicted 785
4 SASI_Hs02_00334313 predicted 398
5 SASI_Hs02_00334314 predicted 455
6 SASI_Hs01_00084061 predicted 749
7 SASI_Hs01_00084063 predicted 655
8 SASI_Hs01_00084064 predicted 286
9 SASI_Hs01_00084065 predicted 848
10 SASI_Hs02_00334315 predicted 354
11 SASI_Hs01_00084062 predicted 324
12 SASI_Hs01_00084066 predicted 865
13 SASI_Hs01_00084067 predicted 327
14 SASI_Hs01_00084068 predicted 768
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178586 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00080515 predicted 316
2 SASI_Hs02_00369841 predicted 384
3 SASI_Hs01_00080516 predicted 785
4 SASI_Hs02_00369842 predicted 405
5 SASI_Hs02_00369843 predicted 455
6 SASI_Hs01_00080517 predicted 751
7 SASI_Hs01_00080519 predicted 659
8 SASI_Hs01_00080520 predicted 293
9 SASI_Hs01_00080521 predicted 852
10 SASI_Hs02_00369844 predicted 363
11 SASI_Hs01_00080518 predicted 316
12 SASI_Hs01_00080522 predicted 867
13 SASI_Hs01_00080523 predicted 326
14 SASI_Hs01_00080524 predicted 774
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178587 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00017524 predicted 322
2 SASI_Hs02_00369845 predicted 390
3 SASI_Hs01_00017525 predicted 787
4 SASI_Hs02_00369846 predicted 396
5 SASI_Hs02_00369847 predicted 446
6 SASI_Hs01_00017526 predicted 755
7 SASI_Hs01_00017528 predicted 661
8 SASI_Hs01_00017529 predicted 293
9 SASI_Hs01_00017530 predicted 850
10 SASI_Hs02_00369848 predicted 362
11 SASI_Hs01_00017527 predicted 325
12 SASI_Hs01_00017531 predicted 865
13 SASI_Hs01_00017532 predicted 333
14 SASI_Hs01_00017533 predicted 768
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178588 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00156309 predicted 318
2 SASI_Hs02_00369849 predicted 384
3 SASI_Hs01_00156310 predicted 792
4 SASI_Hs02_00369850 predicted 401
5 SASI_Hs02_00369851 predicted 447
6 SASI_Hs01_00156311 predicted 747
7 SASI_Hs01_00156313 predicted 659
8 SASI_Hs01_00156314 predicted 289
9 SASI_Hs01_00156315 predicted 854
10 SASI_Hs02_00369852 predicted 357
11 SASI_Hs01_00156312 predicted 323
12 SASI_Hs01_00156316 predicted 866
13 SASI_Hs01_00156317 predicted 332
14 SASI_Hs01_00156318 predicted 768
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001077680 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00358060 predicted 1287
2 SASI_Rn02_00358061 predicted 1353
3 SASI_Rn02_00358062 predicted 1061
4 SASI_Rn02_00358063 predicted 1463
5 SASI_Rn02_00358064 predicted 1308
6 SASI_Rn02_00358065 predicted 418
7 SASI_Rn02_00358066 predicted 650
8 SASI_Rn02_00358067 predicted 1517
9 SASI_Rn02_00358068 predicted 620
10 SASI_Rn02_00358069 predicted 846
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081457 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00298446 predicted 1099
2 SASI_Mm02_00298447 predicted 1064
3 SASI_Mm02_00298448 predicted 923
4 SASI_Mm02_00298449 predicted 369
5 SASI_Mm02_00298450 predicted 1218
6 SASI_Mm02_00298451 predicted 401
7 SASI_Mm02_00298452 predicted 1173
8 SASI_Mm02_00298453 predicted 1120
9 SASI_Mm02_00298454 predicted 804
10 SASI_Mm02_00298455 predicted 812
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081458 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00298456 predicted 1098
2 SASI_Mm02_00298457 predicted 1067
3 SASI_Mm02_00298458 predicted 922
4 SASI_Mm02_00298459 predicted 373
5 SASI_Mm02_00298460 predicted 1216
6 SASI_Mm02_00298461 predicted 405
7 SASI_Mm02_00298462 predicted 1172
8 SASI_Mm02_00298463 predicted 1120
9 SASI_Mm02_00298464 predicted 799
10 SASI_Mm02_00298465 predicted 817
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012023 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00131212 predicted 1096
2 SASI_Mm02_00321978 predicted 1070
3 SASI_Mm02_00321979 predicted 923
4 SASI_Mm01_00131215 predicted 371
5 SASI_Mm02_00321980 predicted 1215
6 SASI_Mm01_00131217 predicted 401
7 SASI_Mm01_00131218 predicted 1168
8 SASI_Mm02_00321981 predicted 1114
9 SASI_Mm01_00131221 predicted 800
10 SASI_Mm02_00321982 predicted 817
11 SASI_Mm01_00131213 predicted 1243
12 SASI_Mm01_00131214 predicted 1119
13 SASI_Mm01_00131216 predicted 1078
14 SASI_Mm01_00131219 predicted 1291
15 SASI_Mm01_00131220 predicted 1092
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002719
VALIDATED
PPP2R5C MISSION shRNA Bacterial Glycerol Stock
protein phosphatase 2, regulatory subunit B', gamma
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000002496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_002719.x-236s1c1
Sequence:CCGGTCCAGAAGTTACGTCAGTGTTCTCGAGAACACTGACGTAACTTCTGGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002494    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A3
TRC Version: 1 Clone ID:NM_002719.x-385s1c1
Sequence:CCGGCCAGAAGTAGTCCATATGTTTCTCGAGAAACATATGGACTACTTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002719.x-1481s1c1
Sequence:CCGGTGGAGACAGATGGGCCTTTATCTCGAGATAAAGGCCCATCTGTCTCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_002719.x-1384s1c1
Sequence:CCGGCGGGAAGAAGCATGGGTTAAACTCGAGTTTAACCCATGCTTCTTCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002497    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002719.x-2823s1c1
Sequence:CCGGCGGTCTTCACATGCTGCTATACTCGAGTATAGCAGCATGTGAAGACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002719.3-583s21c1
Sequence:GTACCGGCAGATTTCCAACCTAATATAGCTCGAGCTATATTAGGTTGGAAATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293424    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_002719.2-363s21c1
Sequence:CCGGTGTGATCACAGAGCCTATTTACTCGAGTAAATAGGCTCTGTGATCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293413    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_002719.2-1384s21c1
Sequence:CCGGCGGGAAGAAGCATGGGTTAAACTCGAGTTTAACCCATGCTTCTTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293412    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_002719.2-385s21c1
Sequence:CCGGCCAGAAGTAGTCCATATGTTTCTCGAGAAACATATGGACTACTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_002719.2-236s21c1
Sequence:CCGGTCCAGAAGTTACGTCAGTGTTCTCGAGAACACTGACGTAACTTCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293484    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002719.2-2057s21c1
Sequence:CCGGCAAATCAAAGGAACGCTTTAACTCGAGTTAAAGCGTTCCTTTGATTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002719
VALIDATED
PPP2R5C MISSION shRNA shRNA Plasmid DNA
protein phosphatase 2, regulatory subunit B', gamma
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000002496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_002719.x-236s1c1
Sequence:CCGGTCCAGAAGTTACGTCAGTGTTCTCGAGAACACTGACGTAACTTCTGGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002494    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A3
TRC Version: 1 Clone ID:NM_002719.x-385s1c1
Sequence:CCGGCCAGAAGTAGTCCATATGTTTCTCGAGAAACATATGGACTACTTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002719.x-1481s1c1
Sequence:CCGGTGGAGACAGATGGGCCTTTATCTCGAGATAAAGGCCCATCTGTCTCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_002719.x-1384s1c1
Sequence:CCGGCGGGAAGAAGCATGGGTTAAACTCGAGTTTAACCCATGCTTCTTCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002497    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002719.x-2823s1c1
Sequence:CCGGCGGTCTTCACATGCTGCTATACTCGAGTATAGCAGCATGTGAAGACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002719.3-583s21c1
Sequence:GTACCGGCAGATTTCCAACCTAATATAGCTCGAGCTATATTAGGTTGGAAATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293424    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_002719.2-363s21c1
Sequence:CCGGTGTGATCACAGAGCCTATTTACTCGAGTAAATAGGCTCTGTGATCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293413    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_002719.2-1384s21c1
Sequence:CCGGCGGGAAGAAGCATGGGTTAAACTCGAGTTTAACCCATGCTTCTTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293412    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_002719.2-385s21c1
Sequence:CCGGCCAGAAGTAGTCCATATGTTTCTCGAGAAACATATGGACTACTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_002719.2-236s21c1
Sequence:CCGGTCCAGAAGTTACGTCAGTGTTCTCGAGAACACTGACGTAACTTCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293484    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002719.2-2057s21c1
Sequence:CCGGCAAATCAAAGGAACGCTTTAACTCGAGTTAAAGCGTTCCTTTGATTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002719
VALIDATED
PPP2R5C MISSION shRNA Lentiviral Transduction Particles
protein phosphatase 2, regulatory subunit B', gamma
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000002496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_002719.x-236s1c1
Sequence:CCGGTCCAGAAGTTACGTCAGTGTTCTCGAGAACACTGACGTAACTTCTGGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002494    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A3
TRC Version: 1 Clone ID:NM_002719.x-385s1c1
Sequence:CCGGCCAGAAGTAGTCCATATGTTTCTCGAGAAACATATGGACTACTTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002719.x-1481s1c1
Sequence:CCGGTGGAGACAGATGGGCCTTTATCTCGAGATAAAGGCCCATCTGTCTCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_002719.x-1384s1c1
Sequence:CCGGCGGGAAGAAGCATGGGTTAAACTCGAGTTTAACCCATGCTTCTTCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002497    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002719.x-2823s1c1
Sequence:CCGGCGGTCTTCACATGCTGCTATACTCGAGTATAGCAGCATGTGAAGACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002719.3-583s21c1
Sequence:GTACCGGCAGATTTCCAACCTAATATAGCTCGAGCTATATTAGGTTGGAAATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293424    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_002719.2-363s21c1
Sequence:CCGGTGTGATCACAGAGCCTATTTACTCGAGTAAATAGGCTCTGTGATCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293413    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_002719.2-1384s21c1
Sequence:CCGGCGGGAAGAAGCATGGGTTAAACTCGAGTTTAACCCATGCTTCTTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293412    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_002719.2-385s21c1
Sequence:CCGGCCAGAAGTAGTCCATATGTTTCTCGAGAAACATATGGACTACTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_002719.2-236s21c1
Sequence:CCGGTCCAGAAGTTACGTCAGTGTTCTCGAGAACACTGACGTAACTTCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293484    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002719.2-2057s21c1
Sequence:CCGGCAAATCAAAGGAACGCTTTAACTCGAGTTAAAGCGTTCCTTTGATTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012023
VALIDATED
PPP2R5C MISSION shRNA Bacterial Glycerol Stock
protein phosphatase 2, regulatory subunit B', gamma
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000080548    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012023.1-528s1c1
Sequence:CCGGGCACAGAATCTATGGGAAGTTCTCGAGAACTTCCCATAGATTCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080549    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012023.1-1085s1c1
Sequence:CCGGCGTCCTTATACCGCAACTCAACTCGAGTTGAGTTGCGGTATAAGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012023.1-1245s1c1
Sequence:CCGGGCGAGAAGAAGCATGGGTTAACTCGAGTTAACCCATGCTTCTTCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012023.1-1134s1c1
Sequence:CCGGCTTGATATACAACGCCCTGAACTCGAGTTCAGGGCGTTGTATATCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012023.1-1035s1c1
Sequence:CCGGCATGAGTTTAATCAGTGACAACTCGAGTTGTCACTGATTAAACTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012023.2-678s21c1
Sequence:CCGGGCACAGAATCTATGGGAAGTTCTCGAGAACTTCCCATAGATTCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012023.2-1284s21c3
Sequence:CCGGCTTGATATACAACGCCCTGAACTCGAGTTCAGGGCGTTGTATATCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000351428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012023.2-1235s21c2
Sequence:CCGGCGTCCTTATACCGCAACTCAACTCGAGTTGAGTTGCGGTATAAGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000351426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012023.2-1185s21c2
Sequence:CCGGCATGAGTTTAATCAGTGACAACTCGAGTTGTCACTGATTAAACTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000351674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012023.2-1395s21c4
Sequence:CCGGGCGAGAAGAAGCATGGGTTAACTCGAGTTAACCCATGCTTCTTCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012023
VALIDATED
PPP2R5C MISSION shRNA shRNA Plasmid DNA
protein phosphatase 2, regulatory subunit B', gamma
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000080548    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012023.1-528s1c1
Sequence:CCGGGCACAGAATCTATGGGAAGTTCTCGAGAACTTCCCATAGATTCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080549    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012023.1-1085s1c1
Sequence:CCGGCGTCCTTATACCGCAACTCAACTCGAGTTGAGTTGCGGTATAAGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012023.1-1245s1c1
Sequence:CCGGGCGAGAAGAAGCATGGGTTAACTCGAGTTAACCCATGCTTCTTCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012023.1-1134s1c1
Sequence:CCGGCTTGATATACAACGCCCTGAACTCGAGTTCAGGGCGTTGTATATCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012023.1-1035s1c1
Sequence:CCGGCATGAGTTTAATCAGTGACAACTCGAGTTGTCACTGATTAAACTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012023.2-678s21c1
Sequence:CCGGGCACAGAATCTATGGGAAGTTCTCGAGAACTTCCCATAGATTCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012023.2-1284s21c3
Sequence:CCGGCTTGATATACAACGCCCTGAACTCGAGTTCAGGGCGTTGTATATCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000351428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012023.2-1235s21c2
Sequence:CCGGCGTCCTTATACCGCAACTCAACTCGAGTTGAGTTGCGGTATAAGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000351426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012023.2-1185s21c2
Sequence:CCGGCATGAGTTTAATCAGTGACAACTCGAGTTGTCACTGATTAAACTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000351674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012023.2-1395s21c4
Sequence:CCGGGCGAGAAGAAGCATGGGTTAACTCGAGTTAACCCATGCTTCTTCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012023
VALIDATED
PPP2R5C MISSION shRNA Lentiviral Transduction Particles
protein phosphatase 2, regulatory subunit B', gamma
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000080548    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012023.1-528s1c1
Sequence:CCGGGCACAGAATCTATGGGAAGTTCTCGAGAACTTCCCATAGATTCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080549    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012023.1-1085s1c1
Sequence:CCGGCGTCCTTATACCGCAACTCAACTCGAGTTGAGTTGCGGTATAAGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012023.1-1245s1c1
Sequence:CCGGGCGAGAAGAAGCATGGGTTAACTCGAGTTAACCCATGCTTCTTCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012023.1-1134s1c1
Sequence:CCGGCTTGATATACAACGCCCTGAACTCGAGTTCAGGGCGTTGTATATCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012023.1-1035s1c1
Sequence:CCGGCATGAGTTTAATCAGTGACAACTCGAGTTGTCACTGATTAAACTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012023.2-678s21c1
Sequence:CCGGGCACAGAATCTATGGGAAGTTCTCGAGAACTTCCCATAGATTCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012023.2-1284s21c3
Sequence:CCGGCTTGATATACAACGCCCTGAACTCGAGTTCAGGGCGTTGTATATCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000351428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012023.2-1235s21c2
Sequence:CCGGCGTCCTTATACCGCAACTCAACTCGAGTTGAGTTGCGGTATAAGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000351426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012023.2-1185s21c2
Sequence:CCGGCATGAGTTTAATCAGTGACAACTCGAGTTGTCACTGATTAAACTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000351674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012023.2-1395s21c4
Sequence:CCGGGCGAGAAGAAGCATGGGTTAACTCGAGTTAACCCATGCTTCTTCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks