EMAIL THIS PAGE TO A FRIEND

PPP3CB

protein phosphatase 3, catalytic subunit, beta isozyme

Synonyms: CALNA2 CALNB CNA2 PP2Bbeta
UniProtKB ID: P16298, P16299, Q5F2F9, Q8N1F0, Q8N3W4
Gene ID:
Mouse(19056) protein phosphatase 3, catalytic subunit, beta isoform
Rat(24675) protein phosphatase 3, catalytic subunit, beta isozyme
naked mole-rat(101708178) protein phosphatase 3, catalytic subunit, beta isozyme
Domestic Rabbit(100009487) protein phosphatase 3, catalytic subunit, beta isozyme
domestic guinea pig(100725315) protein phosphatase 3, catalytic subunit, beta isozyme
cow(100336802) protein phosphatase 3, catalytic subunit, beta isozyme
cow(790867) protein phosphatase 3, catalytic subunit, beta isozyme
sheep(101108104) protein phosphatase 3, catalytic subunit, beta isozyme
Zebrafish(550554) protein phosphatase 3, catalytic subunit, beta isozyme
domestic cat(101086926) protein phosphatase 3, catalytic subunit, beta isozyme
Horse(100072862) protein phosphatase 3, catalytic subunit, beta isozyme
dog(479248) protein phosphatase 3, catalytic subunit, beta isozyme
chicken(378890) protein phosphatase 3, catalytic subunit, beta isozyme
228 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
C3662 Cyclosporin A from Tolypocladium inflatum, ≥95% (HPLC), solid human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021132 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021132 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021132 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008914 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008914 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008914 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021132 Rosetta Predictions human pricing
NM_017042 Rosetta Predictions rat pricing
NM_008914 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021132 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00114380 predicted 1607
2 SASI_Hs01_00114381 predicted 1155
3 SASI_Hs01_00114382 predicted 1576
4 SASI_Hs01_00114383 predicted 1557
5 SASI_Hs01_00114384 predicted 1243
6 SASI_Hs01_00114385 predicted 1596
7 SASI_Hs01_00114386 predicted 1524
8 SASI_Hs01_00114387 predicted 657
9 SASI_Hs01_00114388 predicted 1020
10 SASI_Hs02_00354651 predicted 1068
11 SASI_Hs01_00114379 predicted 594
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017042 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00085700 predicted 1071
2 SASI_Rn01_00085701 predicted 1062
3 SASI_Rn01_00085702 predicted 1165
4 SASI_Rn02_00261228 predicted 1700
5 SASI_Rn01_00085703 predicted 941
6 SASI_Rn01_00085704 predicted 488
7 SASI_Rn01_00085705 predicted 1458
8 SASI_Rn01_00085706 predicted 326
9 SASI_Rn01_00085707 predicted 983
10 SASI_Rn01_00085708 predicted 1520
11 SASI_Rn01_00085709 predicted 396
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008914 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00164361 predicted 573
2 SASI_Mm01_00164362 predicted 1140
3 SASI_Mm02_00314943 predicted 1557
4 SASI_Mm01_00164363 predicted 1520
5 SASI_Mm01_00164364 predicted 1009
6 SASI_Mm02_00314944 predicted 1108
7 SASI_Mm01_00164366 predicted 815
8 SASI_Mm02_00314945 predicted 1587
9 SASI_Mm01_00164368 predicted 518
10 SASI_Mm01_00164369 predicted 1056
11 SASI_Mm01_00164365 predicted 555
12 SASI_Mm01_00164367 predicted 452
13 SASI_Mm01_00164370 predicted 1191
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021132
VALIDATED
PPP3CB MISSION shRNA Bacterial Glycerol Stock
protein phosphatase 3, catalytic subunit, beta isozyme
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000002810    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_021132.x-465s1c1
Sequence:CCGGCCTGCTAATACACGATACCTTCTCGAGAAGGTATCGTGTATTAGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002812    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_021132.x-2890s1c1
Sequence:CCGGCCTGTATTGATTGCCACTGTACTCGAGTACAGTGGCAATCAATACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002813    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_021132.x-889s1c1
Sequence:CCGGGTCACAATACAGTTCGAGGATCTCGAGATCCTCGAACTGTATTGTGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_021132.x-768s1c1
Sequence:CCGGCTGGATGATATTAGGAGATTACTCGAGTAATCTCCTAATATCATCCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_021132.x-1315s1c1
Sequence:CCGGCCCGGAAAGAAATCATAAGAACTCGAGTTCTTATGATTTCTTTCCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021132.2-1334s21c1
Sequence:CCGGCCCGGAAAGAAATCATAAGAACTCGAGTTCTTATGATTTCTTTCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021132.2-787s21c1
Sequence:CCGGCTGGATGATATTAGGAGATTACTCGAGTAATCTCCTAATATCATCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277880    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021132.2-2909s21c1
Sequence:CCGGCCTGTATTGATTGCCACTGTACTCGAGTACAGTGGCAATCAATACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277929    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021132.2-484s21c1
Sequence:CCGGCCTGCTAATACACGATACCTTCTCGAGAAGGTATCGTGTATTAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021132.2-908s21c1
Sequence:CCGGGTCACAATACAGTTCGAGGATCTCGAGATCCTCGAACTGTATTGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021132
VALIDATED
PPP3CB MISSION shRNA shRNA Plasmid DNA
protein phosphatase 3, catalytic subunit, beta isozyme
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000002810    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_021132.x-465s1c1
Sequence:CCGGCCTGCTAATACACGATACCTTCTCGAGAAGGTATCGTGTATTAGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002812    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_021132.x-2890s1c1
Sequence:CCGGCCTGTATTGATTGCCACTGTACTCGAGTACAGTGGCAATCAATACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002813    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_021132.x-889s1c1
Sequence:CCGGGTCACAATACAGTTCGAGGATCTCGAGATCCTCGAACTGTATTGTGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_021132.x-768s1c1
Sequence:CCGGCTGGATGATATTAGGAGATTACTCGAGTAATCTCCTAATATCATCCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_021132.x-1315s1c1
Sequence:CCGGCCCGGAAAGAAATCATAAGAACTCGAGTTCTTATGATTTCTTTCCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021132.2-1334s21c1
Sequence:CCGGCCCGGAAAGAAATCATAAGAACTCGAGTTCTTATGATTTCTTTCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021132.2-787s21c1
Sequence:CCGGCTGGATGATATTAGGAGATTACTCGAGTAATCTCCTAATATCATCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277880    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021132.2-2909s21c1
Sequence:CCGGCCTGTATTGATTGCCACTGTACTCGAGTACAGTGGCAATCAATACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277929    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021132.2-484s21c1
Sequence:CCGGCCTGCTAATACACGATACCTTCTCGAGAAGGTATCGTGTATTAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021132.2-908s21c1
Sequence:CCGGGTCACAATACAGTTCGAGGATCTCGAGATCCTCGAACTGTATTGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021132
VALIDATED
PPP3CB MISSION shRNA Lentiviral Transduction Particles
protein phosphatase 3, catalytic subunit, beta isozyme
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000002810    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_021132.x-465s1c1
Sequence:CCGGCCTGCTAATACACGATACCTTCTCGAGAAGGTATCGTGTATTAGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002812    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_021132.x-2890s1c1
Sequence:CCGGCCTGTATTGATTGCCACTGTACTCGAGTACAGTGGCAATCAATACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002813    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_021132.x-889s1c1
Sequence:CCGGGTCACAATACAGTTCGAGGATCTCGAGATCCTCGAACTGTATTGTGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_021132.x-768s1c1
Sequence:CCGGCTGGATGATATTAGGAGATTACTCGAGTAATCTCCTAATATCATCCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_021132.x-1315s1c1
Sequence:CCGGCCCGGAAAGAAATCATAAGAACTCGAGTTCTTATGATTTCTTTCCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021132.2-1334s21c1
Sequence:CCGGCCCGGAAAGAAATCATAAGAACTCGAGTTCTTATGATTTCTTTCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021132.2-787s21c1
Sequence:CCGGCTGGATGATATTAGGAGATTACTCGAGTAATCTCCTAATATCATCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277880    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021132.2-2909s21c1
Sequence:CCGGCCTGTATTGATTGCCACTGTACTCGAGTACAGTGGCAATCAATACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277929    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021132.2-484s21c1
Sequence:CCGGCCTGCTAATACACGATACCTTCTCGAGAAGGTATCGTGTATTAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021132.2-908s21c1
Sequence:CCGGGTCACAATACAGTTCGAGGATCTCGAGATCCTCGAACTGTATTGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008914
VALIDATED
PPP3CB MISSION shRNA Bacterial Glycerol Stock
protein phosphatase 3, catalytic subunit, beta isozyme
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000081284    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008914.1-179s1c1
Sequence:CCGGCGTCGTCAAAGCTGTTCCTTTCTCGAGAAAGGAACAGCTTTGACGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081287    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008914.1-1113s1c1
Sequence:CCGGGTGATGAACATTCGACAGTTTCTCGAGAAACTGTCGAATGTTCATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008914.1-1114s1c1
Sequence:CCGGTGATGAACATTCGACAGTTTACTCGAGTAAACTGTCGAATGTTCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081285    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008914.1-1303s1c1
Sequence:CCGGCAGCCCGGAAAGAAATCATAACTCGAGTTATGATTTCTTTCCGGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081283    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008914.1-1860s1c1
Sequence:CCGGGCCGTCTATAAGATTGGGTAACTCGAGTTACCCAATCTTATAGACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000351048    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008914.1-1226s21c1
Sequence:CCGGGGTAAATGTTCTGAGTATTTGCTCGAGCAAATACTCAGAACATTTACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008914.1-1113s21c1
Sequence:CCGGGTGATGAACATTCGACAGTTTCTCGAGAAACTGTCGAATGTTCATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008914.1-1303s21c1
Sequence:CCGGCAGCCCGGAAAGAAATCATAACTCGAGTTATGATTTCTTTCCGGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340116    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008914.1-1850s21c1
Sequence:CCGGTGGGACTTGTGCCGTCTATAACTCGAGTTATAGACGGCACAAGTCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008914.1-179s21c1
Sequence:CCGGCGTCGTCAAAGCTGTTCCTTTCTCGAGAAAGGAACAGCTTTGACGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008914
VALIDATED
PPP3CB MISSION shRNA shRNA Plasmid DNA
protein phosphatase 3, catalytic subunit, beta isozyme
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000081284    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008914.1-179s1c1
Sequence:CCGGCGTCGTCAAAGCTGTTCCTTTCTCGAGAAAGGAACAGCTTTGACGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081287    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008914.1-1113s1c1
Sequence:CCGGGTGATGAACATTCGACAGTTTCTCGAGAAACTGTCGAATGTTCATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008914.1-1114s1c1
Sequence:CCGGTGATGAACATTCGACAGTTTACTCGAGTAAACTGTCGAATGTTCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081285    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008914.1-1303s1c1
Sequence:CCGGCAGCCCGGAAAGAAATCATAACTCGAGTTATGATTTCTTTCCGGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081283    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008914.1-1860s1c1
Sequence:CCGGGCCGTCTATAAGATTGGGTAACTCGAGTTACCCAATCTTATAGACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000351048    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008914.1-1226s21c1
Sequence:CCGGGGTAAATGTTCTGAGTATTTGCTCGAGCAAATACTCAGAACATTTACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008914.1-1113s21c1
Sequence:CCGGGTGATGAACATTCGACAGTTTCTCGAGAAACTGTCGAATGTTCATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008914.1-1303s21c1
Sequence:CCGGCAGCCCGGAAAGAAATCATAACTCGAGTTATGATTTCTTTCCGGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340116    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008914.1-1850s21c1
Sequence:CCGGTGGGACTTGTGCCGTCTATAACTCGAGTTATAGACGGCACAAGTCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008914.1-179s21c1
Sequence:CCGGCGTCGTCAAAGCTGTTCCTTTCTCGAGAAAGGAACAGCTTTGACGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008914
VALIDATED
PPP3CB MISSION shRNA Lentiviral Transduction Particles
protein phosphatase 3, catalytic subunit, beta isozyme
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000081284    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008914.1-179s1c1
Sequence:CCGGCGTCGTCAAAGCTGTTCCTTTCTCGAGAAAGGAACAGCTTTGACGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081287    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008914.1-1113s1c1
Sequence:CCGGGTGATGAACATTCGACAGTTTCTCGAGAAACTGTCGAATGTTCATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008914.1-1114s1c1
Sequence:CCGGTGATGAACATTCGACAGTTTACTCGAGTAAACTGTCGAATGTTCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081285    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008914.1-1303s1c1
Sequence:CCGGCAGCCCGGAAAGAAATCATAACTCGAGTTATGATTTCTTTCCGGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081283    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008914.1-1860s1c1
Sequence:CCGGGCCGTCTATAAGATTGGGTAACTCGAGTTACCCAATCTTATAGACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000351048    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008914.1-1226s21c1
Sequence:CCGGGGTAAATGTTCTGAGTATTTGCTCGAGCAAATACTCAGAACATTTACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008914.1-1113s21c1
Sequence:CCGGGTGATGAACATTCGACAGTTTCTCGAGAAACTGTCGAATGTTCATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008914.1-1303s21c1
Sequence:CCGGCAGCCCGGAAAGAAATCATAACTCGAGTTATGATTTCTTTCCGGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340116    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008914.1-1850s21c1
Sequence:CCGGTGGGACTTGTGCCGTCTATAACTCGAGTTATAGACGGCACAAGTCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008914.1-179s21c1
Sequence:CCGGCGTCGTCAAAGCTGTTCCTTTCTCGAGAAAGGAACAGCTTTGACGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks