EMAIL THIS PAGE TO A FRIEND

PPT1

palmitoyl-protein thioesterase 1

Synonyms: CLN1 INCL PPT
UniProtKB ID: P50897, B4DY24, Q6FGQ4
Gene ID:
Human(5538) Summary: The protein encoded by this gene is a small glycoprotein involved in the catabolism of lipid-modified proteins during lysosomal degradation. The encoded enzyme removes thioester-linked fatty acyl groups such as palmitate from cysteine residues. Defects in this gene are a cause of infantile neuronal ceroid lipofuscinosis 1 (CLN1, or INCL) and neuronal ceroid lipofuscinosis 4 (CLN4). Two transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Dec 2008]
Mouse(19063) palmitoyl-protein thioesterase 1
Rat(29411) palmitoyl-protein thioesterase 1
fruit fly(31805) Palmitoyl-protein thioesterase 1
chicken(419681) palmitoyl-protein thioesterase 1
dog(475316) palmitoyl-protein thioesterase 1
domestic cat(101097408) palmitoyl-protein thioesterase 1
Zebrafish(406648) palmitoyl-protein thioesterase 1 (ceroid-lipofuscinosis, neuronal 1, infantile)
Thale Cress(828466) 4-hydroxybenzoate polyprenyltransferase
naked mole-rat(101718692) palmitoyl-protein thioesterase 1
domestic guinea pig(100720295) palmitoyl-protein thioesterase 1
cow(281421) palmitoyl-protein thioesterase 1
sheep(101121049) palmitoyl-protein thioesterase 1
sheep(100170397) palmitoyl-protein thioesterase 1
64 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008917 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008917 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008917 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000310 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000310 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000310 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000310 Rosetta Predictions human pricing
NM_022502 Rosetta Predictions rat pricing
NM_008917 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000310 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00149125 predicted 812
2 SASI_Hs01_00149126 predicted 239
3 SASI_Hs01_00149127 predicted 251
4 SASI_Hs01_00149128 predicted 198
5 SASI_Hs02_00302306 predicted 681
6 SASI_Hs01_00149129 predicted 969
7 SASI_Hs01_00149130 predicted 374
8 SASI_Hs01_00149131 predicted 875
9 SASI_Hs01_00149132 predicted 756
10 SASI_Hs01_00149134 predicted 1080
11 SASI_Hs01_00149133 predicted 398
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022502 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00058258 predicted 524
2 SASI_Rn02_00263207 predicted 496
3 SASI_Rn02_00263208 predicted 865
4 SASI_Rn01_00058262 predicted 886
5 SASI_Rn01_00058263 predicted 1015
6 SASI_Rn01_00058264 predicted 303
7 SASI_Rn01_00058265 predicted 505
8 SASI_Rn01_00058266 predicted 390
9 SASI_Rn02_00263209 predicted 624
10 SASI_Rn02_00263210 predicted 626
11 SASI_Rn01_00058259 predicted 927
12 SASI_Rn01_00058260 predicted 496
13 SASI_Rn01_00058261 predicted 327
14 SASI_Rn01_00058267 predicted 942
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008917 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00162457 predicted 479
2 SASI_Mm02_00314950 predicted 336
3 SASI_Mm02_00314951 predicted 318
4 SASI_Mm01_00162458 predicted 532
5 SASI_Mm01_00162459 predicted 900
6 SASI_Mm01_00162460 predicted 418
7 SASI_Mm01_00162463 predicted 281
8 SASI_Mm01_00162465 predicted 522
9 SASI_Mm01_00162464 predicted 936
10 SASI_Mm01_00162466 predicted 503
11 SASI_Mm01_00162461 predicted 455
12 SASI_Mm01_00162462 predicted 259
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008917
VALIDATED
PPT1 MISSION shRNA Bacterial Glycerol Stock
palmitoyl-protein thioesterase 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000202373    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008917.1-361s1c1
Sequence:CCGGGCAGCAGGGATACAATGCTATCTCGAGATAGCATTGTATCCCTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000202003    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008917.1-763s1c1
Sequence:CCGGCGACTCTGAGTGGTTTGGATTCTCGAGAATCCAAACCACTCAGAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191270    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008917.1-1317s1c1
Sequence:CCGGCCATACAAATTTGGAGCAAATCTCGAGATTTGCTCCAAATTTGTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008917.1-718s1c1
Sequence:CCGGGTTTGTGATGGTGAAATTCTTCTCGAGAAGAATTTCACCATCACAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292728    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008917.2-1286s21c1
Sequence:CCGGCCATACAAATTTGGAGCAAATCTCGAGATTTGCTCCAAATTTGTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008917.2-329s21c1
Sequence:CCGGGCAGCAGGGATACAATGCTATCTCGAGATAGCATTGTATCCCTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292658    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008917.2-686s21c1
Sequence:CCGGGTTTGTGATGGTGAAATTCTTCTCGAGAAGAATTTCACCATCACAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008917.2-731s21c1
Sequence:CCGGCGACTCTGAGTGGTTTGGATTCTCGAGAATCCAAACCACTCAGAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008917
VALIDATED
PPT1 MISSION shRNA shRNA Plasmid DNA
palmitoyl-protein thioesterase 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000202373    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008917.1-361s1c1
Sequence:CCGGGCAGCAGGGATACAATGCTATCTCGAGATAGCATTGTATCCCTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000202003    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008917.1-763s1c1
Sequence:CCGGCGACTCTGAGTGGTTTGGATTCTCGAGAATCCAAACCACTCAGAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191270    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008917.1-1317s1c1
Sequence:CCGGCCATACAAATTTGGAGCAAATCTCGAGATTTGCTCCAAATTTGTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008917.1-718s1c1
Sequence:CCGGGTTTGTGATGGTGAAATTCTTCTCGAGAAGAATTTCACCATCACAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292728    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008917.2-1286s21c1
Sequence:CCGGCCATACAAATTTGGAGCAAATCTCGAGATTTGCTCCAAATTTGTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008917.2-329s21c1
Sequence:CCGGGCAGCAGGGATACAATGCTATCTCGAGATAGCATTGTATCCCTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292658    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008917.2-686s21c1
Sequence:CCGGGTTTGTGATGGTGAAATTCTTCTCGAGAAGAATTTCACCATCACAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008917.2-731s21c1
Sequence:CCGGCGACTCTGAGTGGTTTGGATTCTCGAGAATCCAAACCACTCAGAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008917
VALIDATED
PPT1 MISSION shRNA Lentiviral Transduction Particles
palmitoyl-protein thioesterase 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000202373    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008917.1-361s1c1
Sequence:CCGGGCAGCAGGGATACAATGCTATCTCGAGATAGCATTGTATCCCTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000202003    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008917.1-763s1c1
Sequence:CCGGCGACTCTGAGTGGTTTGGATTCTCGAGAATCCAAACCACTCAGAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191270    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008917.1-1317s1c1
Sequence:CCGGCCATACAAATTTGGAGCAAATCTCGAGATTTGCTCCAAATTTGTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008917.1-718s1c1
Sequence:CCGGGTTTGTGATGGTGAAATTCTTCTCGAGAAGAATTTCACCATCACAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292728    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008917.2-1286s21c1
Sequence:CCGGCCATACAAATTTGGAGCAAATCTCGAGATTTGCTCCAAATTTGTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008917.2-329s21c1
Sequence:CCGGGCAGCAGGGATACAATGCTATCTCGAGATAGCATTGTATCCCTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292658    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008917.2-686s21c1
Sequence:CCGGGTTTGTGATGGTGAAATTCTTCTCGAGAAGAATTTCACCATCACAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008917.2-731s21c1
Sequence:CCGGCGACTCTGAGTGGTTTGGATTCTCGAGAATCCAAACCACTCAGAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000310
VALIDATED
PPT1 MISSION shRNA Bacterial Glycerol Stock
palmitoyl-protein thioesterase 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000029218    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_000310.1-250s1c1
Sequence:CCGGCGTGGAGAACAGCTTCTTCTTCTCGAGAAGAAGAAGCTGTTCTCCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000310.1-578s1c1
Sequence:CCGGCCCATAAAGGAGGATGTGTATCTCGAGATACACATCCTCCTTTATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029216    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_000310.1-305s1c1
Sequence:CCGGGCACTTGCTAAGGATCCTAAACTCGAGTTTAGGATCCTTAGCAAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029217    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_000310.1-908s1c1
Sequence:CCGGGCCCACATCATACCATTCCTTCTCGAGAAGGAATGGTATGATGTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029215    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_000310.1-725s1c1
Sequence:CCGGCCTGTAGATTCGGAGTGGTTTCTCGAGAAACCACTCCGAATCTACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000310.3-417s21c1
Sequence:CCGGTACCTGGAATTTACGTCTTATCTCGAGATAAGACGTAAATTCCAGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_000310.3-524s21c1
Sequence:CCGGGCACTTGCTAAGGATCCTAAACTCGAGTTTAGGATCCTTAGCAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293381    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_000310.3-1127s21c1
Sequence:CCGGGCCCACATCATACCATTCCTTCTCGAGAAGGAATGGTATGATGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000310.3-469s21c1
Sequence:CCGGCGTGGAGAACAGCTTCTTCTTCTCGAGAAGAAGAAGCTGTTCTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298496    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000310.3-1243s21c1
Sequence:CCGGCAGATCCAGCTTGCAACTAATCTCGAGATTAGTTGCAAGCTGGATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000310
VALIDATED
PPT1 MISSION shRNA shRNA Plasmid DNA
palmitoyl-protein thioesterase 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000029218    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_000310.1-250s1c1
Sequence:CCGGCGTGGAGAACAGCTTCTTCTTCTCGAGAAGAAGAAGCTGTTCTCCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000310.1-578s1c1
Sequence:CCGGCCCATAAAGGAGGATGTGTATCTCGAGATACACATCCTCCTTTATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029216    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_000310.1-305s1c1
Sequence:CCGGGCACTTGCTAAGGATCCTAAACTCGAGTTTAGGATCCTTAGCAAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029217    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_000310.1-908s1c1
Sequence:CCGGGCCCACATCATACCATTCCTTCTCGAGAAGGAATGGTATGATGTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029215    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_000310.1-725s1c1
Sequence:CCGGCCTGTAGATTCGGAGTGGTTTCTCGAGAAACCACTCCGAATCTACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000310.3-417s21c1
Sequence:CCGGTACCTGGAATTTACGTCTTATCTCGAGATAAGACGTAAATTCCAGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_000310.3-524s21c1
Sequence:CCGGGCACTTGCTAAGGATCCTAAACTCGAGTTTAGGATCCTTAGCAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293381    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_000310.3-1127s21c1
Sequence:CCGGGCCCACATCATACCATTCCTTCTCGAGAAGGAATGGTATGATGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000310.3-469s21c1
Sequence:CCGGCGTGGAGAACAGCTTCTTCTTCTCGAGAAGAAGAAGCTGTTCTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298496    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000310.3-1243s21c1
Sequence:CCGGCAGATCCAGCTTGCAACTAATCTCGAGATTAGTTGCAAGCTGGATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000310
VALIDATED
PPT1 MISSION shRNA Lentiviral Transduction Particles
palmitoyl-protein thioesterase 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000029218    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_000310.1-250s1c1
Sequence:CCGGCGTGGAGAACAGCTTCTTCTTCTCGAGAAGAAGAAGCTGTTCTCCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000310.1-578s1c1
Sequence:CCGGCCCATAAAGGAGGATGTGTATCTCGAGATACACATCCTCCTTTATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029216    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_000310.1-305s1c1
Sequence:CCGGGCACTTGCTAAGGATCCTAAACTCGAGTTTAGGATCCTTAGCAAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029217    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_000310.1-908s1c1
Sequence:CCGGGCCCACATCATACCATTCCTTCTCGAGAAGGAATGGTATGATGTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029215    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_000310.1-725s1c1
Sequence:CCGGCCTGTAGATTCGGAGTGGTTTCTCGAGAAACCACTCCGAATCTACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000310.3-417s21c1
Sequence:CCGGTACCTGGAATTTACGTCTTATCTCGAGATAAGACGTAAATTCCAGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_000310.3-524s21c1
Sequence:CCGGGCACTTGCTAAGGATCCTAAACTCGAGTTTAGGATCCTTAGCAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293381    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_000310.3-1127s21c1
Sequence:CCGGGCCCACATCATACCATTCCTTCTCGAGAAGGAATGGTATGATGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000310.3-469s21c1
Sequence:CCGGCGTGGAGAACAGCTTCTTCTTCTCGAGAAGAAGAAGCTGTTCTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298496    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000310.3-1243s21c1
Sequence:CCGGCAGATCCAGCTTGCAACTAATCTCGAGATTAGTTGCAAGCTGGATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks