EMAIL THIS PAGE TO A FRIEND

PQLC2

PQ loop repeat containing 2

UniProtKB ID: Q6ZP29, B3KWQ5, Q6ZMJ3, Q6ZP27, Q9NXC7
Gene ID:
Mouse(212555) PQ loop repeat containing 2
Rat(362642) PQ loop repeat containing 2
Zebrafish(503709) PQ loop repeat containing 2
chicken(419472) PQ loop repeat containing 2
dog(487405) PQ loop repeat containing 2
domestic cat(101090031) PQ loop repeat containing 2
cow(512930) PQ loop repeat containing 2
sheep(101109152) PQ loop repeat containing 2
naked mole-rat(101702760) PQ loop repeat containing 2
domestic guinea pig(100723829) PQ loop repeat containing 2
77 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017765 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017765 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017765 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145384 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145384 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145384 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001040125 Rosetta Predictions human pricing
NM_001040126 Rosetta Predictions human pricing
NM_017765 Rosetta Predictions human pricing
NM_001108689 Rosetta Predictions rat pricing
XM_342958 Rosetta Predictions rat pricing
NM_145384 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040125 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00024939 predicted 1324
2 SASI_Hs01_00024940 predicted 1521
3 SASI_Hs01_00024941 predicted 1450
4 SASI_Hs01_00024942 predicted 1256
5 SASI_Hs01_00024943 predicted 1247
6 SASI_Hs01_00024944 predicted 1261
7 SASI_Hs01_00024945 predicted 1316
8 SASI_Hs01_00024946 predicted 1372
9 SASI_Hs01_00024947 predicted 1241
10 SASI_Hs02_00308840 predicted 1295
11 SASI_Hs01_00024948 predicted 1527
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040126 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00123840 predicted 719
2 SASI_Hs01_00123841 predicted 913
3 SASI_Hs01_00123842 predicted 845
4 SASI_Hs01_00123843 predicted 646
5 SASI_Hs01_00123844 predicted 635
6 SASI_Hs01_00123845 predicted 650
7 SASI_Hs01_00123846 predicted 707
8 SASI_Hs01_00123847 predicted 757
9 SASI_Hs01_00123848 predicted 628
10 SASI_Hs02_00308841 predicted 683
11 SASI_Hs01_00123849 predicted 913
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017765 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00195173 predicted 958
2 SASI_Hs01_00195174 predicted 1160
3 SASI_Hs01_00195175 predicted 1080
4 SASI_Hs01_00195176 predicted 886
5 SASI_Hs01_00195177 predicted 871
6 SASI_Hs01_00195178 predicted 891
7 SASI_Hs01_00195179 predicted 947
8 SASI_Hs01_00195180 predicted 996
9 SASI_Hs01_00195181 predicted 872
10 SASI_Hs02_00350591 predicted 920
11 SASI_Hs01_00195182 predicted 1157
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108689 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00241105 predicted 898
2 SASI_Rn02_00241106 predicted 555
3 SASI_Rn02_00241107 predicted 514
4 SASI_Rn02_00241108 predicted 1003
5 SASI_Rn02_00241109 predicted 874
6 SASI_Rn02_00241110 predicted 597
7 SASI_Rn02_00241111 predicted 784
8 SASI_Rn02_00241112 predicted 881
9 SASI_Rn02_00241113 predicted 956
10 SASI_Rn02_00241114 predicted 323
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_342958 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00127851 predicted 1089
2 SASI_Rn01_00127852 predicted 1178
3 SASI_Rn01_00127853 predicted 1117
4 SASI_Rn01_00127854 predicted 1099
5 SASI_Rn01_00127855 predicted 1182
6 SASI_Rn01_00127856 predicted 1176
7 SASI_Rn01_00127857 predicted 1194
8 SASI_Rn01_00127858 predicted 1181
9 SASI_Rn01_00127859 predicted 1125
10 SASI_Rn01_00127860 predicted 1146
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145384 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00108240 predicted 540
2 SASI_Mm01_00108241 predicted 875
3 SASI_Mm01_00108242 predicted 885
4 SASI_Mm01_00108243 predicted 1782
5 SASI_Mm01_00108244 predicted 491
6 SASI_Mm01_00108245 predicted 1067
7 SASI_Mm01_00108246 predicted 761
8 SASI_Mm01_00108247 predicted 851
9 SASI_Mm01_00108248 predicted 674
10 SASI_Mm01_00108249 predicted 925
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017765
VALIDATED
PQLC2 MISSION shRNA Bacterial Glycerol Stock
PQ loop repeat containing 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000444798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017765.2-916s21c1
Sequence:CCGGCTCCATCTCCAGCGTGTTGTACTCGAGTACAACACGCTGGAGATGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424568    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017765.2-416s21c1
Sequence:CCGGATATGGGATGTGTTGGGTGAACTCGAGTTCACCCAACACATCCCATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122797    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_017765.1-564s1c1
Sequence:CCGGGCAGACCTACACGGCTGTGTACTCGAGTACACAGCCGTGTAGGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121655    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017765.1-1804s1c1
Sequence:CCGGGCCGAGATTTCAGGATAAGTTCTCGAGAACTTATCCTGAAATCTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_017765.1-604s1c1
Sequence:CCGGGTGATGCTGACGCTGTACTTTCTCGAGAAAGTACAGCGTCAGCATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143603    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017765.1-1558s1c1
Sequence:CCGGGAGAACAGTCTCAGCACAATTCTCGAGAATTGTGCTGAGACTGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142629    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017765.1-2500s1c1
Sequence:CCGGCCGTTTCTTCATCCCATGAGACTCGAGTCTCATGGGATGAAGAAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141313    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_017765.1-2506s1c1
Sequence:CCGGCTTCATCCCATGAGACCAGTACTCGAGTACTGGTCTCATGGGATGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141716    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017765.1-2496s1c1
Sequence:CCGGGAAGCCGTTTCTTCATCCCATCTCGAGATGGGATGAAGAAACGGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143213    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017765.1-582s1c1
Sequence:CCGGGTATTATGTCTTGGCAGACCTCTCGAGAGGTCTGCCAAGACATAATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017765
VALIDATED
PQLC2 MISSION shRNA shRNA Plasmid DNA
PQ loop repeat containing 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000444798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017765.2-916s21c1
Sequence:CCGGCTCCATCTCCAGCGTGTTGTACTCGAGTACAACACGCTGGAGATGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424568    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017765.2-416s21c1
Sequence:CCGGATATGGGATGTGTTGGGTGAACTCGAGTTCACCCAACACATCCCATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122797    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_017765.1-564s1c1
Sequence:CCGGGCAGACCTACACGGCTGTGTACTCGAGTACACAGCCGTGTAGGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121655    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017765.1-1804s1c1
Sequence:CCGGGCCGAGATTTCAGGATAAGTTCTCGAGAACTTATCCTGAAATCTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_017765.1-604s1c1
Sequence:CCGGGTGATGCTGACGCTGTACTTTCTCGAGAAAGTACAGCGTCAGCATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143603    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017765.1-1558s1c1
Sequence:CCGGGAGAACAGTCTCAGCACAATTCTCGAGAATTGTGCTGAGACTGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142629    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017765.1-2500s1c1
Sequence:CCGGCCGTTTCTTCATCCCATGAGACTCGAGTCTCATGGGATGAAGAAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141313    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_017765.1-2506s1c1
Sequence:CCGGCTTCATCCCATGAGACCAGTACTCGAGTACTGGTCTCATGGGATGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141716    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017765.1-2496s1c1
Sequence:CCGGGAAGCCGTTTCTTCATCCCATCTCGAGATGGGATGAAGAAACGGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143213    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017765.1-582s1c1
Sequence:CCGGGTATTATGTCTTGGCAGACCTCTCGAGAGGTCTGCCAAGACATAATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017765
VALIDATED
PQLC2 MISSION shRNA Lentiviral Transduction Particles
PQ loop repeat containing 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000444798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017765.2-916s21c1
Sequence:CCGGCTCCATCTCCAGCGTGTTGTACTCGAGTACAACACGCTGGAGATGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424568    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017765.2-416s21c1
Sequence:CCGGATATGGGATGTGTTGGGTGAACTCGAGTTCACCCAACACATCCCATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122797    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_017765.1-564s1c1
Sequence:CCGGGCAGACCTACACGGCTGTGTACTCGAGTACACAGCCGTGTAGGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121655    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017765.1-1804s1c1
Sequence:CCGGGCCGAGATTTCAGGATAAGTTCTCGAGAACTTATCCTGAAATCTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_017765.1-604s1c1
Sequence:CCGGGTGATGCTGACGCTGTACTTTCTCGAGAAAGTACAGCGTCAGCATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143603    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017765.1-1558s1c1
Sequence:CCGGGAGAACAGTCTCAGCACAATTCTCGAGAATTGTGCTGAGACTGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142629    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017765.1-2500s1c1
Sequence:CCGGCCGTTTCTTCATCCCATGAGACTCGAGTCTCATGGGATGAAGAAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141313    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_017765.1-2506s1c1
Sequence:CCGGCTTCATCCCATGAGACCAGTACTCGAGTACTGGTCTCATGGGATGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141716    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017765.1-2496s1c1
Sequence:CCGGGAAGCCGTTTCTTCATCCCATCTCGAGATGGGATGAAGAAACGGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143213    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017765.1-582s1c1
Sequence:CCGGGTATTATGTCTTGGCAGACCTCTCGAGAGGTCTGCCAAGACATAATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145384
VALIDATED
PQLC2 MISSION shRNA Bacterial Glycerol Stock
PQ loop repeat containing 2
Mouse
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000216692    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145384.1-1165s1c1
Sequence:CCGGCCATTAGCACATTCACCTATTCTCGAGAATAGGTGAATGTGCTAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217492    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145384.1-1191s1c1
Sequence:CCGGGTGTGTCCTTCCATCTACAATCTCGAGATTGTAGATGGAAGGACACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340898    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_145384.2-1490s21c1
Sequence:CCGGGACTGGATACAACCTAGTAAACTCGAGTTTACTAGGTTGTATCCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145384.2-782s21c1
Sequence:CCGGGTCTGTGGAGCCAGGCAATAACTCGAGTTATTGCCTGGCTCCACAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340974    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_145384.2-814s21c1
Sequence:CCGGAGAAGGAGGTCATCGGCTTTGCTCGAGCAAAGCCGATGACCTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340973    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_145384.2-614s21c1
Sequence:CCGGGCTGACGCTGTACTTCCATTACTCGAGTAATGGAAGTACAGCGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000352468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_145384.2-879s21c1
Sequence:CCGGCCTCAGATTCGCACCAATTTCCTCGAGGAAATTGGTGCGAATCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183467    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145384.1-2070s1c1
Sequence:CCGGGCAAGAAGTAAACACGATCTTCTCGAGAAGATCGTGTTTACTTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145384.1-863s1c1
Sequence:CCGGCCAATTTCATACGGCAGTCAACTCGAGTTGACTGCCGTATGAAATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183086    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145384.1-1332s1c1
Sequence:CCGGCCTTCATCTATAATCCAACATCTCGAGATGTTGGATTATAGATGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196084    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145384.1-849s1c1
Sequence:CCGGGCCTCAGATTCGCACCAATTTCTCGAGAAATTGGTGCGAATCTGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195885    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145384.1-1266s1c1
Sequence:CCGGCCCACTTAGACACCTATCCATCTCGAGATGGATAGGTGTCTAAGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195819    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145384.1-1213s1c1
Sequence:CCGGCAGCCTTTAACCACCCTTCATCTCGAGATGAAGGGTGGTTAAAGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184598    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_145384.1-585s1c1
Sequence:CCGGGCTGACGCTGTACTTCCATTACTCGAGTAATGGAAGTACAGCGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145384
VALIDATED
PQLC2 MISSION shRNA shRNA Plasmid DNA
PQ loop repeat containing 2
Mouse
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000216692    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145384.1-1165s1c1
Sequence:CCGGCCATTAGCACATTCACCTATTCTCGAGAATAGGTGAATGTGCTAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217492    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145384.1-1191s1c1
Sequence:CCGGGTGTGTCCTTCCATCTACAATCTCGAGATTGTAGATGGAAGGACACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340898    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_145384.2-1490s21c1
Sequence:CCGGGACTGGATACAACCTAGTAAACTCGAGTTTACTAGGTTGTATCCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145384.2-782s21c1
Sequence:CCGGGTCTGTGGAGCCAGGCAATAACTCGAGTTATTGCCTGGCTCCACAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340974    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_145384.2-814s21c1
Sequence:CCGGAGAAGGAGGTCATCGGCTTTGCTCGAGCAAAGCCGATGACCTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340973    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_145384.2-614s21c1
Sequence:CCGGGCTGACGCTGTACTTCCATTACTCGAGTAATGGAAGTACAGCGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000352468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_145384.2-879s21c1
Sequence:CCGGCCTCAGATTCGCACCAATTTCCTCGAGGAAATTGGTGCGAATCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183467    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145384.1-2070s1c1
Sequence:CCGGGCAAGAAGTAAACACGATCTTCTCGAGAAGATCGTGTTTACTTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145384.1-863s1c1
Sequence:CCGGCCAATTTCATACGGCAGTCAACTCGAGTTGACTGCCGTATGAAATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183086    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145384.1-1332s1c1
Sequence:CCGGCCTTCATCTATAATCCAACATCTCGAGATGTTGGATTATAGATGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196084    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145384.1-849s1c1
Sequence:CCGGGCCTCAGATTCGCACCAATTTCTCGAGAAATTGGTGCGAATCTGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195885    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145384.1-1266s1c1
Sequence:CCGGCCCACTTAGACACCTATCCATCTCGAGATGGATAGGTGTCTAAGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195819    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145384.1-1213s1c1
Sequence:CCGGCAGCCTTTAACCACCCTTCATCTCGAGATGAAGGGTGGTTAAAGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184598    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_145384.1-585s1c1
Sequence:CCGGGCTGACGCTGTACTTCCATTACTCGAGTAATGGAAGTACAGCGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145384
VALIDATED
PQLC2 MISSION shRNA Lentiviral Transduction Particles
PQ loop repeat containing 2
Mouse
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000216692    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145384.1-1165s1c1
Sequence:CCGGCCATTAGCACATTCACCTATTCTCGAGAATAGGTGAATGTGCTAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217492    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145384.1-1191s1c1
Sequence:CCGGGTGTGTCCTTCCATCTACAATCTCGAGATTGTAGATGGAAGGACACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340898    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_145384.2-1490s21c1
Sequence:CCGGGACTGGATACAACCTAGTAAACTCGAGTTTACTAGGTTGTATCCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145384.2-782s21c1
Sequence:CCGGGTCTGTGGAGCCAGGCAATAACTCGAGTTATTGCCTGGCTCCACAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340974    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_145384.2-814s21c1
Sequence:CCGGAGAAGGAGGTCATCGGCTTTGCTCGAGCAAAGCCGATGACCTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340973    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_145384.2-614s21c1
Sequence:CCGGGCTGACGCTGTACTTCCATTACTCGAGTAATGGAAGTACAGCGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000352468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_145384.2-879s21c1
Sequence:CCGGCCTCAGATTCGCACCAATTTCCTCGAGGAAATTGGTGCGAATCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183467    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145384.1-2070s1c1
Sequence:CCGGGCAAGAAGTAAACACGATCTTCTCGAGAAGATCGTGTTTACTTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145384.1-863s1c1
Sequence:CCGGCCAATTTCATACGGCAGTCAACTCGAGTTGACTGCCGTATGAAATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183086    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145384.1-1332s1c1
Sequence:CCGGCCTTCATCTATAATCCAACATCTCGAGATGTTGGATTATAGATGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196084    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145384.1-849s1c1
Sequence:CCGGGCCTCAGATTCGCACCAATTTCTCGAGAAATTGGTGCGAATCTGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195885    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145384.1-1266s1c1
Sequence:CCGGCCCACTTAGACACCTATCCATCTCGAGATGGATAGGTGTCTAAGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195819    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145384.1-1213s1c1
Sequence:CCGGCAGCCTTTAACCACCCTTCATCTCGAGATGAAGGGTGGTTAAAGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184598    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_145384.1-585s1c1
Sequence:CCGGGCTGACGCTGTACTTCCATTACTCGAGTAATGGAAGTACAGCGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks