EMAIL THIS PAGE TO A FRIEND

PRAME

preferentially expressed antigen in melanoma

Synonyms: CT130 MAPE OIP-4 OIP4
UniProtKB ID: P78395, B2R6Y7, O43481, Q8IXN8
Gene ID:
Human(23532) Summary: This gene encodes an antigen that is predominantly expressed in human melanomas and that is recognized by cytolytic T lymphocytes. It is not expressed in normal tissues, except testis. This expression pattern is similar to that of other CT antigens, such as MAGE, BAGE and GAGE. However, unlike these other CT antigens, this gene is also expressed in acute leukemias. Five alternatively spliced transcript variants encoding the same protein have been observed for this gene. [provided by RefSeq, Jul 2008]
Mouse(75829) preferentially expressed antigen in melanoma
Rat(680000) preferentially expressed antigen in melanoma
Horse(100061889) preferentially expressed antigen in melanoma
domestic cat(101086260) preferentially expressed antigen in melanoma
dog(477552) preferentially expressed antigen in melanoma
cow(785023) preferentially expressed antigen in melanoma
sheep(101108258) preferentially expressed antigen in melanoma
cow(528601) preferentially expressed antigen in melanoma
naked mole-rat(101711995) preferentially expressed antigen in melanoma
domestic guinea pig(100731688) preferentially expressed antigen in melanoma
123 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_029459 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029459 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029459 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_206953 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_206953 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_206953 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006115 Rosetta Predictions human pricing
NM_206953 Rosetta Predictions human pricing
NM_206954 Rosetta Predictions human pricing
NM_206955 Rosetta Predictions human pricing
NM_206956 Rosetta Predictions human pricing
XM_001055257 Rosetta Predictions rat pricing
XM_136073 Rosetta Predictions mouse pricing
XM_906050 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006115 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00125994 predicted 1011
2 SASI_Hs01_00125996 predicted 1855
3 SASI_Hs01_00125997 predicted 613
4 SASI_Hs01_00125998 predicted 1762
5 SASI_Hs01_00125999 predicted 1148
6 SASI_Hs01_00126000 predicted 656
7 SASI_Hs01_00126001 predicted 609
8 SASI_Hs02_00340932 predicted 789
9 SASI_Hs01_00126002 predicted 835
10 SASI_Hs01_00126003 predicted 755
11 SASI_Hs01_00125995 predicted 1298
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_206953 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00125754 predicted 1625
2 SASI_Hs01_00125756 predicted 2471
3 SASI_Hs01_00125757 predicted 1236
4 SASI_Hs01_00125758 predicted 2385
5 SASI_Hs01_00125759 predicted 1757
6 SASI_Hs01_00125760 predicted 1273
7 SASI_Hs01_00125761 predicted 1226
8 SASI_Hs02_00373656 predicted 1405
9 SASI_Hs01_00125762 predicted 1442
10 SASI_Hs01_00125763 predicted 1374
11 SASI_Hs01_00125755 predicted 1918
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_206954 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00095884 predicted 997
2 SASI_Hs01_00095886 predicted 1833
3 SASI_Hs01_00095887 predicted 595
4 SASI_Hs01_00095888 predicted 1749
5 SASI_Hs01_00095889 predicted 1125
6 SASI_Hs01_00095890 predicted 639
7 SASI_Hs01_00095891 predicted 589
8 SASI_Hs02_00373657 predicted 768
9 SASI_Hs01_00095892 predicted 815
10 SASI_Hs01_00095893 predicted 737
11 SASI_Hs01_00095885 predicted 1280
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_206955 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00026097 predicted 1075
2 SASI_Hs01_00026099 predicted 1916
3 SASI_Hs01_00026100 predicted 680
4 SASI_Hs01_00026101 predicted 1827
5 SASI_Hs01_00026102 predicted 1204
6 SASI_Hs01_00026103 predicted 714
7 SASI_Hs01_00026104 predicted 665
8 SASI_Hs02_00373658 predicted 851
9 SASI_Hs01_00026105 predicted 890
10 SASI_Hs01_00026106 predicted 810
11 SASI_Hs01_00026098 predicted 1356
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_206956 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00159053 predicted 1048
2 SASI_Hs01_00159055 predicted 1891
3 SASI_Hs01_00159056 predicted 650
4 SASI_Hs01_00159057 predicted 1799
5 SASI_Hs01_00159058 predicted 1179
6 SASI_Hs01_00159059 predicted 698
7 SASI_Hs01_00159060 predicted 642
8 SASI_Hs02_00373659 predicted 832
9 SASI_Hs01_00159061 predicted 874
10 SASI_Hs01_00159062 predicted 796
11 SASI_Hs01_00159054 predicted 1336
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001055257 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00278986 predicted 1071
2 SASI_Rn02_00278987 predicted 708
3 SASI_Rn02_00278988 predicted 996
4 SASI_Rn02_00278989 predicted 869
5 SASI_Rn02_00278990 predicted 1049
6 SASI_Rn02_00278991 predicted 475
7 SASI_Rn02_00278992 predicted 775
8 SASI_Rn02_00278993 predicted 833
9 SASI_Rn02_00278994 predicted 349
10 SASI_Rn02_00278995 predicted 624
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_136073 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00279618 predicted 2008
2 SASI_Mm01_00279619 predicted 1731
3 SASI_Mm01_00279620 predicted 1612
4 SASI_Mm01_00279621 predicted 1971
5 SASI_Mm01_00279622 predicted 1978
6 SASI_Mm01_00279623 predicted 1210
7 SASI_Mm01_00279624 predicted 1508
8 SASI_Mm01_00279625 predicted 1361
9 SASI_Mm02_00424675 predicted 1716
10 SASI_Mm01_00279626 predicted 1843
11 SASI_Mm01_00279627 predicted 1408
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_906050 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00432306 predicted 2007
2 SASI_Mm02_00432307 predicted 1734
3 SASI_Mm02_00432308 predicted 1608
4 SASI_Mm02_00432309 predicted 1966
5 SASI_Mm02_00432310 predicted 1983
6 SASI_Mm02_00432311 predicted 1207
7 SASI_Mm02_00432312 predicted 1507
8 SASI_Mm02_00432313 predicted 1363
9 SASI_Mm02_00432314 predicted 1713
10 SASI_Mm02_00432315 predicted 1836
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029459
PRAME MISSION shRNA Bacterial Glycerol Stock
preferentially expressed antigen in melanoma
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000346688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029459.1-849s21c1
Sequence:CCGGTGCCTTCACGGGAGGATATAGCTCGAGCTATATCCTCCCGTGAAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029459.1-1152s21c1
Sequence:CCGGGTACAGCATTGTAGATCTAAACTCGAGTTTAGATCTACAATGCTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029459.1-763s21c1
Sequence:CCGGATACAGAGTCTACTAAGTAATCTCGAGATTACTTAGTAGACTCTGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346690    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029459.1-1115s21c1
Sequence:CCGGCTCACTCTGTACACTCTATTCCTCGAGGAATAGAGTGTACAGAGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029459.1-1502s21c1
Sequence:CCGGTCCGAGTGTTCCTCAACTATCCTCGAGGATAGTTGAGGAACACTCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029459
PRAME MISSION shRNA shRNA Plasmid DNA
preferentially expressed antigen in melanoma
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000346688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029459.1-849s21c1
Sequence:CCGGTGCCTTCACGGGAGGATATAGCTCGAGCTATATCCTCCCGTGAAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029459.1-1152s21c1
Sequence:CCGGGTACAGCATTGTAGATCTAAACTCGAGTTTAGATCTACAATGCTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029459.1-763s21c1
Sequence:CCGGATACAGAGTCTACTAAGTAATCTCGAGATTACTTAGTAGACTCTGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346690    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029459.1-1115s21c1
Sequence:CCGGCTCACTCTGTACACTCTATTCCTCGAGGAATAGAGTGTACAGAGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029459.1-1502s21c1
Sequence:CCGGTCCGAGTGTTCCTCAACTATCCTCGAGGATAGTTGAGGAACACTCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029459
PRAME MISSION shRNA Lentiviral Transduction Particles
preferentially expressed antigen in melanoma
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000346688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029459.1-849s21c1
Sequence:CCGGTGCCTTCACGGGAGGATATAGCTCGAGCTATATCCTCCCGTGAAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029459.1-1152s21c1
Sequence:CCGGGTACAGCATTGTAGATCTAAACTCGAGTTTAGATCTACAATGCTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029459.1-763s21c1
Sequence:CCGGATACAGAGTCTACTAAGTAATCTCGAGATTACTTAGTAGACTCTGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346690    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029459.1-1115s21c1
Sequence:CCGGCTCACTCTGTACACTCTATTCCTCGAGGAATAGAGTGTACAGAGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029459.1-1502s21c1
Sequence:CCGGTCCGAGTGTTCCTCAACTATCCTCGAGGATAGTTGAGGAACACTCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_206953
VALIDATED
PRAME MISSION shRNA Bacterial Glycerol Stock
preferentially expressed antigen in melanoma
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000289632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206953.1-1423s21c1
Sequence:CCGGCCTGTGATGAATTGTTCTCCTCTCGAGAGGAGAACAATTCATCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206953.1-1556s21c1
Sequence:CCGGGCTGGACTCTATTGAAGATTTCTCGAGAAATCTTCAATAGAGTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289631    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206953.1-1633s21c1
Sequence:CCGGGCCAGATGATTAATCTGCGTACTCGAGTACGCAGATTAATCATCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296271    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_206953.1-2588s21c1
Sequence:CCGGATGTTGACTTGAGGAGTTAATCTCGAGATTAACTCCTCAAGTCAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115702    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_206953.1-2400s1c1
Sequence:CCGGGCACATATCAAATGCTTCATTCTCGAGAATGAAGCATTTGATATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_206953.1-1633s1c1
Sequence:CCGGGCCAGATGATTAATCTGCGTACTCGAGTACGCAGATTAATCATCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115705    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_206953.1-1423s1c1
Sequence:CCGGCCTGTGATGAATTGTTCTCCTCTCGAGAGGAGAACAATTCATCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206953.1-2077s1c1
Sequence:CCGGGCTCCCAGCTTACAACCTTAACTCGAGTTAAGGTTGTAAGCTGGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115703    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_206953.1-1556s1c1
Sequence:CCGGGCTGGACTCTATTGAAGATTTCTCGAGAAATCTTCAATAGAGTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_206953
VALIDATED
PRAME MISSION shRNA shRNA Plasmid DNA
preferentially expressed antigen in melanoma
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000289632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206953.1-1423s21c1
Sequence:CCGGCCTGTGATGAATTGTTCTCCTCTCGAGAGGAGAACAATTCATCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206953.1-1556s21c1
Sequence:CCGGGCTGGACTCTATTGAAGATTTCTCGAGAAATCTTCAATAGAGTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289631    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206953.1-1633s21c1
Sequence:CCGGGCCAGATGATTAATCTGCGTACTCGAGTACGCAGATTAATCATCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296271    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_206953.1-2588s21c1
Sequence:CCGGATGTTGACTTGAGGAGTTAATCTCGAGATTAACTCCTCAAGTCAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115702    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_206953.1-2400s1c1
Sequence:CCGGGCACATATCAAATGCTTCATTCTCGAGAATGAAGCATTTGATATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_206953.1-1633s1c1
Sequence:CCGGGCCAGATGATTAATCTGCGTACTCGAGTACGCAGATTAATCATCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115705    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_206953.1-1423s1c1
Sequence:CCGGCCTGTGATGAATTGTTCTCCTCTCGAGAGGAGAACAATTCATCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206953.1-2077s1c1
Sequence:CCGGGCTCCCAGCTTACAACCTTAACTCGAGTTAAGGTTGTAAGCTGGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115703    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_206953.1-1556s1c1
Sequence:CCGGGCTGGACTCTATTGAAGATTTCTCGAGAAATCTTCAATAGAGTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_206953
VALIDATED
PRAME MISSION shRNA Lentiviral Transduction Particles
preferentially expressed antigen in melanoma
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000289632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206953.1-1423s21c1
Sequence:CCGGCCTGTGATGAATTGTTCTCCTCTCGAGAGGAGAACAATTCATCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206953.1-1556s21c1
Sequence:CCGGGCTGGACTCTATTGAAGATTTCTCGAGAAATCTTCAATAGAGTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289631    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206953.1-1633s21c1
Sequence:CCGGGCCAGATGATTAATCTGCGTACTCGAGTACGCAGATTAATCATCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296271    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_206953.1-2588s21c1
Sequence:CCGGATGTTGACTTGAGGAGTTAATCTCGAGATTAACTCCTCAAGTCAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115702    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_206953.1-2400s1c1
Sequence:CCGGGCACATATCAAATGCTTCATTCTCGAGAATGAAGCATTTGATATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_206953.1-1633s1c1
Sequence:CCGGGCCAGATGATTAATCTGCGTACTCGAGTACGCAGATTAATCATCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115705    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_206953.1-1423s1c1
Sequence:CCGGCCTGTGATGAATTGTTCTCCTCTCGAGAGGAGAACAATTCATCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206953.1-2077s1c1
Sequence:CCGGGCTCCCAGCTTACAACCTTAACTCGAGTTAAGGTTGTAAGCTGGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115703    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_206953.1-1556s1c1
Sequence:CCGGGCTGGACTCTATTGAAGATTTCTCGAGAAATCTTCAATAGAGTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks