EMAIL THIS PAGE TO A FRIEND

PRAMEF8

PRAME family member 8

UniProtKB ID: Q5VWM4
Gene ID:
Mouse(242736) PRAME family member 8
Rat(502994) PRAME family member 8
52 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1301076 ANTI-PRAMEF8 (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
flow cytometry, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172877 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172877 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172877 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001012276 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001012276 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001012276 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU065791 MISSION® esiRNA esiRNA targeting mouse 4732496O08Rik (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001012276 Rosetta Predictions human pricing
XM_001073706 Rosetta Predictions rat pricing
XM_578504 Rosetta Predictions rat pricing
NM_172877 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012276 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00083720 predicted 505
2 SASI_Hs01_00083722 predicted 833
3 SASI_Hs01_00083723 predicted 298
4 SASI_Hs01_00083724 predicted 402
5 SASI_Hs01_00083725 predicted 1521
6 SASI_Hs01_00083726 predicted 406
7 SASI_Hs01_00083727 predicted 879
8 SASI_Hs01_00083728 predicted 889
9 SASI_Hs01_00083729 predicted 470
10 SASI_Hs02_00306068 predicted 897
11 SASI_Hs01_00083721 predicted 884
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001073706 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00343625 predicted 946
2 SASI_Rn02_00343626 predicted 825
3 SASI_Rn02_00343627 predicted 559
4 SASI_Rn02_00343628 predicted 1404
5 SASI_Rn02_00343629 predicted 847
6 SASI_Rn02_00343630 predicted 859
7 SASI_Rn02_00343631 predicted 894
8 SASI_Rn02_00343632 predicted 449
9 SASI_Rn02_00343633 predicted 251
10 SASI_Rn02_00343634 predicted 886
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_578504 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00408017 predicted 1114
2 SASI_Rn02_00408018 predicted 827
3 SASI_Rn02_00408019 predicted 1409
4 SASI_Rn02_00408020 predicted 842
5 SASI_Rn02_00408021 predicted 864
6 SASI_Rn02_00408022 predicted 900
7 SASI_Rn02_00408023 predicted 252
8 SASI_Rn02_00408024 predicted 888
9 SASI_Rn02_00408025 predicted 1103
10 SASI_Rn02_00408026 predicted 265
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172877 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00058715 predicted 1739
2 SASI_Mm01_00058716 predicted 1371
3 SASI_Mm01_00058717 predicted 1535
4 SASI_Mm01_00058718 predicted 2118
5 SASI_Mm01_00058719 predicted 1675
6 SASI_Mm01_00058720 predicted 2153
7 SASI_Mm01_00058721 predicted 1220
8 SASI_Mm01_00058722 predicted 2071
9 SASI_Mm01_00058723 predicted 1474
10 SASI_Mm01_00058724 predicted 881
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172877
VALIDATED
PRAMEF8 MISSION shRNA Bacterial Glycerol Stock
PRAME family member 8
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000175900    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172877.1-1276s1c1
Sequence:CCGGGAAGAAGTTCCATACGGCTATCTCGAGATAGCCGTATGGAACTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174467    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172877.1-886s1c1
Sequence:CCGGCCTTCAATCACAGACAAACTACTCGAGTAGTTTGTCTGTGATTGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000283014    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172877.2-3171s21c1
Sequence:CCGGCCGGTAAGCCAGTCTAGTAAACTCGAGTTTACTAGACTGGCTTACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264379    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172877.2-1213s21c1
Sequence:CCGGCCTGTGCCTCAGGTTCCATTTCTCGAGAAATGGAACCTGAGGCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264381    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172877.2-2183s21c1
Sequence:CCGGTGTCGTTGTCGGCAGTAAATACTCGAGTATTTACTGCCGACAACGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216903    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172877.2-2114s1c1
Sequence:CCGGGTCTCCTTTGCTACGTATATCCTCGAGGATATACGTAGCAAAGGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264380    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172877.2-2113s21c1
Sequence:CCGGTGTCTCCTTTGCTACGTATATCTCGAGATATACGTAGCAAAGGAGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000283016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172877.2-1374s21c1
Sequence:CCGGTCCAAGAATTGGAACTAAATACTCGAGTATTTAGTTCCAATTCTTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172877
VALIDATED
PRAMEF8 MISSION shRNA shRNA Plasmid DNA
PRAME family member 8
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000175900    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172877.1-1276s1c1
Sequence:CCGGGAAGAAGTTCCATACGGCTATCTCGAGATAGCCGTATGGAACTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174467    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172877.1-886s1c1
Sequence:CCGGCCTTCAATCACAGACAAACTACTCGAGTAGTTTGTCTGTGATTGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000283014    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172877.2-3171s21c1
Sequence:CCGGCCGGTAAGCCAGTCTAGTAAACTCGAGTTTACTAGACTGGCTTACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264379    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172877.2-1213s21c1
Sequence:CCGGCCTGTGCCTCAGGTTCCATTTCTCGAGAAATGGAACCTGAGGCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264381    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172877.2-2183s21c1
Sequence:CCGGTGTCGTTGTCGGCAGTAAATACTCGAGTATTTACTGCCGACAACGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216903    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172877.2-2114s1c1
Sequence:CCGGGTCTCCTTTGCTACGTATATCCTCGAGGATATACGTAGCAAAGGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264380    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172877.2-2113s21c1
Sequence:CCGGTGTCTCCTTTGCTACGTATATCTCGAGATATACGTAGCAAAGGAGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000283016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172877.2-1374s21c1
Sequence:CCGGTCCAAGAATTGGAACTAAATACTCGAGTATTTAGTTCCAATTCTTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172877
VALIDATED
PRAMEF8 MISSION shRNA Lentiviral Transduction Particles
PRAME family member 8
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000175900    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172877.1-1276s1c1
Sequence:CCGGGAAGAAGTTCCATACGGCTATCTCGAGATAGCCGTATGGAACTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174467    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172877.1-886s1c1
Sequence:CCGGCCTTCAATCACAGACAAACTACTCGAGTAGTTTGTCTGTGATTGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000283014    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172877.2-3171s21c1
Sequence:CCGGCCGGTAAGCCAGTCTAGTAAACTCGAGTTTACTAGACTGGCTTACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264379    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172877.2-1213s21c1
Sequence:CCGGCCTGTGCCTCAGGTTCCATTTCTCGAGAAATGGAACCTGAGGCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264381    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172877.2-2183s21c1
Sequence:CCGGTGTCGTTGTCGGCAGTAAATACTCGAGTATTTACTGCCGACAACGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216903    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172877.2-2114s1c1
Sequence:CCGGGTCTCCTTTGCTACGTATATCCTCGAGGATATACGTAGCAAAGGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264380    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172877.2-2113s21c1
Sequence:CCGGTGTCTCCTTTGCTACGTATATCTCGAGATATACGTAGCAAAGGAGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000283016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172877.2-1374s21c1
Sequence:CCGGTCCAAGAATTGGAACTAAATACTCGAGTATTTAGTTCCAATTCTTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001012276
PRAMEF8 MISSION shRNA Bacterial Glycerol Stock
PRAME family member 8
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000172545    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012276.1-1391s1c1
Sequence:CCGGGATGAAGACACTGAGGGACTTCTCGAGAAGTCCCTCAGTGTCTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172271    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001012276.1-1547s1c1
Sequence:CCGGCTGGTCATTTCGGAGCTGAAACTCGAGTTTCAGCTCCGAAATGACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246330    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001012276.1-1609s21c1
Sequence:CCGGGTTTCAAATGCCTCCTCAGTGCTCGAGCACTGAGGAGGCATTTGAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246329    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001012276.1-1514s21c1
Sequence:CCGGTGCCATCAGGGTGGATATATTCTCGAGAATATATCCACCCTGATGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246328    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001012276.1-1559s21c1
Sequence:CCGGGAGCTGAAACCTAGGCCATGACTCGAGTCATGGCCTAGGTTTCAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257503    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001012276.1-1621s21c1
Sequence:CCGGTCCTCAGTGTGAATGGGAAAGCTCGAGCTTTCCCATTCACACTGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257509    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001012276.1-1545s21c1
Sequence:CCGGTTCTGGTCATTTCGGAGCTGACTCGAGTCAGCTCCGAAATGACCAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001012276
PRAMEF8 MISSION shRNA shRNA Plasmid DNA
PRAME family member 8
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000172545    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012276.1-1391s1c1
Sequence:CCGGGATGAAGACACTGAGGGACTTCTCGAGAAGTCCCTCAGTGTCTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172271    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001012276.1-1547s1c1
Sequence:CCGGCTGGTCATTTCGGAGCTGAAACTCGAGTTTCAGCTCCGAAATGACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246330    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001012276.1-1609s21c1
Sequence:CCGGGTTTCAAATGCCTCCTCAGTGCTCGAGCACTGAGGAGGCATTTGAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246329    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001012276.1-1514s21c1
Sequence:CCGGTGCCATCAGGGTGGATATATTCTCGAGAATATATCCACCCTGATGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246328    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001012276.1-1559s21c1
Sequence:CCGGGAGCTGAAACCTAGGCCATGACTCGAGTCATGGCCTAGGTTTCAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257503    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001012276.1-1621s21c1
Sequence:CCGGTCCTCAGTGTGAATGGGAAAGCTCGAGCTTTCCCATTCACACTGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257509    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001012276.1-1545s21c1
Sequence:CCGGTTCTGGTCATTTCGGAGCTGACTCGAGTCAGCTCCGAAATGACCAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001012276
PRAMEF8 MISSION shRNA Lentiviral Transduction Particles
PRAME family member 8
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000172545    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012276.1-1391s1c1
Sequence:CCGGGATGAAGACACTGAGGGACTTCTCGAGAAGTCCCTCAGTGTCTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172271    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001012276.1-1547s1c1
Sequence:CCGGCTGGTCATTTCGGAGCTGAAACTCGAGTTTCAGCTCCGAAATGACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246330    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001012276.1-1609s21c1
Sequence:CCGGGTTTCAAATGCCTCCTCAGTGCTCGAGCACTGAGGAGGCATTTGAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246329    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001012276.1-1514s21c1
Sequence:CCGGTGCCATCAGGGTGGATATATTCTCGAGAATATATCCACCCTGATGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246328    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001012276.1-1559s21c1
Sequence:CCGGGAGCTGAAACCTAGGCCATGACTCGAGTCATGGCCTAGGTTTCAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257503    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001012276.1-1621s21c1
Sequence:CCGGTCCTCAGTGTGAATGGGAAAGCTCGAGCTTTCCCATTCACACTGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257509    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001012276.1-1545s21c1
Sequence:CCGGTTCTGGTCATTTCGGAGCTGACTCGAGTCAGCTCCGAAATGACCAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks