EMAIL THIS PAGE TO A FRIEND

PRCC

papillary renal cell carcinoma (translocation-associated)

Synonyms: RCCP1 TPRC
UniProtKB ID: Q92733, A8K1F7, O00665, O00724, Q5SZ06
Gene ID:
Human(5546) Summary: This gene encodes a protein that may play a role in pre-mRNA splicing. Chromosomal translocations (X;1)(p11;q21) that result in fusion of this gene to TFE3 (GeneID 7030) have been associated with papillary renal cell carcinoma. A PRCC-TFE3 fusion protein is expressed in affected carcinomas and is likely associated with altered gene transactivation. This fusion protein has also been associated with disruption of the cell cycle.[provided by RefSeq, Aug 2010]
Mouse(94315) papillary renal cell carcinoma (translocation-associated)
Rat(310687) papillary renal cell carcinoma (translocation-associated)
Zebrafish(572173) papillary renal cell carcinoma (translocation-associated)
chicken(425977) papillary renal cell carcinoma (translocation-associated)
domestic cat(101082371) papillary renal cell carcinoma (translocation-associated)
dog(610063) papillary renal cell carcinoma (translocation-associated)
domestic guinea pig(100716006) papillary renal cell carcinoma (translocation-associated)
naked mole-rat(101723477) papillary renal cell carcinoma (translocation-associated)
cow(507189) papillary renal cell carcinoma (translocation-associated)
sheep(101109505) papillary renal cell carcinoma (translocation-associated)
83 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005973 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005973 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005973 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_033573 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_033573 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_033573 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005973 Rosetta Predictions human pricing
NM_199416 Rosetta Predictions human pricing
NM_001107700 Rosetta Predictions rat pricing
NM_033573 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005973 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00027066 predicted 1142
2 SASI_Hs01_00027067 predicted 734
3 SASI_Hs01_00027068 predicted 1066
4 SASI_Hs01_00027069 predicted 1732
5 SASI_Hs01_00027070 predicted 307
6 SASI_Hs01_00027071 predicted 747
7 SASI_Hs01_00027072 predicted 739
8 SASI_Hs01_00027074 predicted 1145
9 SASI_Hs01_00027075 predicted 578
10 SASI_Hs02_00340654 predicted 947
11 SASI_Hs01_00027073 predicted 709
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199416 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00235346 predicted 1139
2 SASI_Hs01_00235347 predicted 738
3 SASI_Hs01_00235348 predicted 1069
4 SASI_Hs01_00235349 predicted 1636
5 SASI_Hs01_00235350 predicted 312
6 SASI_Hs01_00235351 predicted 752
7 SASI_Hs01_00235352 predicted 741
8 SASI_Hs01_00235354 predicted 1144
9 SASI_Hs01_00235355 predicted 577
10 SASI_Hs02_00372814 predicted 945
11 SASI_Hs01_00235353 predicted 717
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107700 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00231415 predicted 1291
2 SASI_Rn02_00231416 predicted 1040
3 SASI_Rn02_00231417 predicted 1599
4 SASI_Rn02_00231418 predicted 1586
5 SASI_Rn02_00231419 predicted 855
6 SASI_Rn02_00231420 predicted 1299
7 SASI_Rn02_00231421 predicted 1702
8 SASI_Rn02_00231422 predicted 1456
9 SASI_Rn02_00231423 predicted 1090
10 SASI_Rn02_00231424 predicted 320
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033573 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00041604 predicted 1306
2 SASI_Mm01_00041605 predicted 1599
3 SASI_Mm01_00041606 predicted 1496
4 SASI_Mm01_00041607 predicted 969
5 SASI_Mm01_00041608 predicted 1595
6 SASI_Mm01_00041609 predicted 699
7 SASI_Mm01_00041611 predicted 653
8 SASI_Mm01_00041612 predicted 1691
9 SASI_Mm01_00041613 predicted 1297
10 SASI_Mm02_00337407 predicted 1147
11 SASI_Mm01_00041610 predicted 1518
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005973
VALIDATED
PRCC MISSION shRNA Bacterial Glycerol Stock
papillary renal cell carcinoma (translocation-associated)
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000344814    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005973.4-1892s21c1
Sequence:CCGGCTGCGAGAATGAACATATTTGCTCGAGCAAATATGTTCATTCTCGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293664    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005973.4-1951s21c1
Sequence:CCGGTCTGTCCTGGAGCTAGCAAAGCTCGAGCTTTGCTAGCTCCAGGACAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005973.4-1356s21c1
Sequence:CCGGGCTGGTGCTTATTATCAGGATCTCGAGATCCTGATAATAAGCACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286215    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005973.4-1652s21c1
Sequence:CCGGACACCAGATCACATATCTTATCTCGAGATAAGATATGTGATCTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293665    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005973.4-1452s21c1
Sequence:CCGGTTCATCGATGACGAAGCATTTCTCGAGAAATGCTTCGTCATCGATGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293727    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005973.4-1737s21c1
Sequence:CCGGCGTCAGACCCAAGCCAAATATCTCGAGATATTTGGCTTGGGTCTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075073    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005973.4-1894s1c1
Sequence:CCGGGCGAGAATGAACATATTTGATCTCGAGATCAAATATGTTCATTCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075076    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005973.4-1356s1c1
Sequence:CCGGGCTGGTGCTTATTATCAGGATCTCGAGATCCTGATAATAAGCACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005973.4-1652s1c1
Sequence:CCGGACACCAGATCACATATCTTATCTCGAGATAAGATATGTGATCTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075075    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005973.4-1647s1c1
Sequence:CCGGCGGAAACACCAGATCACATATCTCGAGATATGTGATCTGGTGTTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005973.4-739s1c1
Sequence:CCGGCGGAGTTGCATAAGGGAGATTCTCGAGAATCTCCCTTATGCAACTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005973
VALIDATED
PRCC MISSION shRNA shRNA Plasmid DNA
papillary renal cell carcinoma (translocation-associated)
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000344814    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005973.4-1892s21c1
Sequence:CCGGCTGCGAGAATGAACATATTTGCTCGAGCAAATATGTTCATTCTCGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293664    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005973.4-1951s21c1
Sequence:CCGGTCTGTCCTGGAGCTAGCAAAGCTCGAGCTTTGCTAGCTCCAGGACAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005973.4-1356s21c1
Sequence:CCGGGCTGGTGCTTATTATCAGGATCTCGAGATCCTGATAATAAGCACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286215    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005973.4-1652s21c1
Sequence:CCGGACACCAGATCACATATCTTATCTCGAGATAAGATATGTGATCTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293665    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005973.4-1452s21c1
Sequence:CCGGTTCATCGATGACGAAGCATTTCTCGAGAAATGCTTCGTCATCGATGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293727    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005973.4-1737s21c1
Sequence:CCGGCGTCAGACCCAAGCCAAATATCTCGAGATATTTGGCTTGGGTCTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075073    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005973.4-1894s1c1
Sequence:CCGGGCGAGAATGAACATATTTGATCTCGAGATCAAATATGTTCATTCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075076    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005973.4-1356s1c1
Sequence:CCGGGCTGGTGCTTATTATCAGGATCTCGAGATCCTGATAATAAGCACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005973.4-1652s1c1
Sequence:CCGGACACCAGATCACATATCTTATCTCGAGATAAGATATGTGATCTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075075    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005973.4-1647s1c1
Sequence:CCGGCGGAAACACCAGATCACATATCTCGAGATATGTGATCTGGTGTTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005973.4-739s1c1
Sequence:CCGGCGGAGTTGCATAAGGGAGATTCTCGAGAATCTCCCTTATGCAACTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005973
VALIDATED
PRCC MISSION shRNA Lentiviral Transduction Particles
papillary renal cell carcinoma (translocation-associated)
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000344814    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005973.4-1892s21c1
Sequence:CCGGCTGCGAGAATGAACATATTTGCTCGAGCAAATATGTTCATTCTCGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293664    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005973.4-1951s21c1
Sequence:CCGGTCTGTCCTGGAGCTAGCAAAGCTCGAGCTTTGCTAGCTCCAGGACAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005973.4-1356s21c1
Sequence:CCGGGCTGGTGCTTATTATCAGGATCTCGAGATCCTGATAATAAGCACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286215    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005973.4-1652s21c1
Sequence:CCGGACACCAGATCACATATCTTATCTCGAGATAAGATATGTGATCTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293665    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005973.4-1452s21c1
Sequence:CCGGTTCATCGATGACGAAGCATTTCTCGAGAAATGCTTCGTCATCGATGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293727    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005973.4-1737s21c1
Sequence:CCGGCGTCAGACCCAAGCCAAATATCTCGAGATATTTGGCTTGGGTCTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075073    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005973.4-1894s1c1
Sequence:CCGGGCGAGAATGAACATATTTGATCTCGAGATCAAATATGTTCATTCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075076    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005973.4-1356s1c1
Sequence:CCGGGCTGGTGCTTATTATCAGGATCTCGAGATCCTGATAATAAGCACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005973.4-1652s1c1
Sequence:CCGGACACCAGATCACATATCTTATCTCGAGATAAGATATGTGATCTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075075    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005973.4-1647s1c1
Sequence:CCGGCGGAAACACCAGATCACATATCTCGAGATATGTGATCTGGTGTTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005973.4-739s1c1
Sequence:CCGGCGGAGTTGCATAAGGGAGATTCTCGAGAATCTCCCTTATGCAACTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033573
PRCC MISSION shRNA Bacterial Glycerol Stock
papillary renal cell carcinoma (translocation-associated)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000123751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033573.1-1614s1c1
Sequence:CCGGCATATCTGATTCATCAGGCTACTCGAGTAGCCTGATGAATCAGATATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033573.1-853s1c1
Sequence:CCGGCTCCCGGAAACCTTCAGATATCTCGAGATATCTGAAGGTTTCCGGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033573.1-1412s1c1
Sequence:CCGGGATGAAGCATTTAAGCGGCTACTCGAGTAGCCGCTTAAATGCTTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123749    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033573.1-1834s1c1
Sequence:CCGGGCTCTGGAGAAGGAACATATTCTCGAGAATATGTTCCTTCTCCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033573.1-1308s1c1
Sequence:CCGGCTGGTGCTTATTATCAGGATTCTCGAGAATCCTGATAATAAGCACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033573
PRCC MISSION shRNA shRNA Plasmid DNA
papillary renal cell carcinoma (translocation-associated)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000123751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033573.1-1614s1c1
Sequence:CCGGCATATCTGATTCATCAGGCTACTCGAGTAGCCTGATGAATCAGATATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033573.1-853s1c1
Sequence:CCGGCTCCCGGAAACCTTCAGATATCTCGAGATATCTGAAGGTTTCCGGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033573.1-1412s1c1
Sequence:CCGGGATGAAGCATTTAAGCGGCTACTCGAGTAGCCGCTTAAATGCTTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123749    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033573.1-1834s1c1
Sequence:CCGGGCTCTGGAGAAGGAACATATTCTCGAGAATATGTTCCTTCTCCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033573.1-1308s1c1
Sequence:CCGGCTGGTGCTTATTATCAGGATTCTCGAGAATCCTGATAATAAGCACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033573
PRCC MISSION shRNA Lentiviral Transduction Particles
papillary renal cell carcinoma (translocation-associated)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000123751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033573.1-1614s1c1
Sequence:CCGGCATATCTGATTCATCAGGCTACTCGAGTAGCCTGATGAATCAGATATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033573.1-853s1c1
Sequence:CCGGCTCCCGGAAACCTTCAGATATCTCGAGATATCTGAAGGTTTCCGGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033573.1-1412s1c1
Sequence:CCGGGATGAAGCATTTAAGCGGCTACTCGAGTAGCCGCTTAAATGCTTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123749    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033573.1-1834s1c1
Sequence:CCGGGCTCTGGAGAAGGAACATATTCTCGAGAATATGTTCCTTCTCCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033573.1-1308s1c1
Sequence:CCGGCTGGTGCTTATTATCAGGATTCTCGAGAATCCTGATAATAAGCACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks