EMAIL THIS PAGE TO A FRIEND

PRDM16

PR domain containing 16

Synonyms: CMD1LL LVNC8 MEL1 PFM13
Gene ID:
Human(63976) Summary: The reciprocal translocation t(1;3)(p36;q21) occurs in a subset of myelodysplastic syndrome (MDS) and acute myeloid leukemia (AML). This gene is located near the 1p36.3 breakpoint and has been shown to be specifically expressed in the t(1:3)(p36,q21)-positive MDS/AML. The protein encoded by this gene is a zinc finger transcription factor and contains an N-terminal PR domain. The translocation results in the overexpression of a truncated version of this protein that lacks the PR domain, which may play an important role in the pathogenesis of MDS and AML. Alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008]
Mouse(70673) PR domain containing 16
Rat(100366024) PR domain containing 16
domestic guinea pig(100714489) PR domain containing 16
naked mole-rat(101721685) PR domain containing 16
cow(100137803) PR domain containing 16
sheep(101120004) PR domain containing 16
Zebrafish(559174) PR domain containing 16
chicken(419388) PR domain containing 16
dog(479582) PR domain containing 16
Horse(100060844) PR domain containing 16
domestic cat(101090880) PR domain containing 16
99 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022114 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022114 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022114 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027504 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027504 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027504 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022114 Rosetta Predictions human pricing
NM_199454 Rosetta Predictions human pricing
NM_027504 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022114 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00169553 predicted 2164
2 SASI_Hs01_00169554 predicted 1881
3 SASI_Hs01_00169555 predicted 3090
4 SASI_Hs01_00169556 predicted 539
5 SASI_Hs01_00169557 predicted 2918
6 SASI_Hs01_00169558 predicted 2767
7 SASI_Hs01_00169559 predicted 1023
8 SASI_Hs01_00169560 predicted 443
9 SASI_Hs01_00169561 predicted 1233
10 SASI_Hs01_00169562 predicted 1255
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199454 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00096514 predicted 2169
2 SASI_Hs01_00096515 predicted 1880
3 SASI_Hs01_00096516 predicted 3093
4 SASI_Hs01_00096517 predicted 534
5 SASI_Hs01_00096518 predicted 2915
6 SASI_Hs01_00096519 predicted 2775
7 SASI_Hs01_00096520 predicted 1023
8 SASI_Hs01_00096521 predicted 447
9 SASI_Hs01_00096522 predicted 1231
10 SASI_Hs01_00096523 predicted 1253
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027504 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00154717 predicted 3048
2 SASI_Mm01_00154718 predicted 356
3 SASI_Mm01_00154719 predicted 3739
4 SASI_Mm01_00154720 predicted 3750
5 SASI_Mm01_00154721 predicted 2795
6 SASI_Mm01_00154722 predicted 1066
7 SASI_Mm01_00154723 predicted 304
8 SASI_Mm01_00154724 predicted 662
9 SASI_Mm01_00154725 predicted 1136
10 SASI_Mm01_00154726 predicted 3727
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022114
PRDM16 MISSION shRNA Bacterial Glycerol Stock
PR domain containing 16
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000367912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022114.2-2173s21c1
Sequence:CCGGCCATTGCCGAGAAGTACTTTGCTCGAGCAAAGTACTTCTCGGCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022114.2-3274s21c1
Sequence:CCGGACGAGAAAGAAGACTCTTATTCTCGAGAATAAGAGTCTTCTTTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367875    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022114.2-4361s21c1
Sequence:CCGGATTGACTGCAGAGTCTATTTACTCGAGTAAATAGACTCTGCAGTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022114.2-3318s1c1
Sequence:CCGGGCCAATAGTGAGATGAACCAACTCGAGTTGGTTCATCTCACTATTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022114.2-2315s1c1
Sequence:CCGGCGCCCACAACTTGCTGGTCAACTCGAGTTGACCAGCAAGTTGTGGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020048    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022114.2-1246s1c1
Sequence:CCGGGCACGGTGAAGCCTTTCATATCTCGAGATATGAAAGGCTTCACCGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022114.2-122s1c1
Sequence:CCGGCGGTGACGTTGTAAATAATATCTCGAGATATTATTTACAACGTCACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022114.2-3759s1c1
Sequence:CCGGCAGGCTAAGAACCAGGCATATCTCGAGATATGCCTGGTTCTTAGCCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022114
PRDM16 MISSION shRNA shRNA Plasmid DNA
PR domain containing 16
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000367912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022114.2-2173s21c1
Sequence:CCGGCCATTGCCGAGAAGTACTTTGCTCGAGCAAAGTACTTCTCGGCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022114.2-3274s21c1
Sequence:CCGGACGAGAAAGAAGACTCTTATTCTCGAGAATAAGAGTCTTCTTTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367875    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022114.2-4361s21c1
Sequence:CCGGATTGACTGCAGAGTCTATTTACTCGAGTAAATAGACTCTGCAGTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022114.2-3318s1c1
Sequence:CCGGGCCAATAGTGAGATGAACCAACTCGAGTTGGTTCATCTCACTATTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022114.2-2315s1c1
Sequence:CCGGCGCCCACAACTTGCTGGTCAACTCGAGTTGACCAGCAAGTTGTGGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020048    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022114.2-1246s1c1
Sequence:CCGGGCACGGTGAAGCCTTTCATATCTCGAGATATGAAAGGCTTCACCGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022114.2-122s1c1
Sequence:CCGGCGGTGACGTTGTAAATAATATCTCGAGATATTATTTACAACGTCACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022114.2-3759s1c1
Sequence:CCGGCAGGCTAAGAACCAGGCATATCTCGAGATATGCCTGGTTCTTAGCCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022114
PRDM16 MISSION shRNA Lentiviral Transduction Particles
PR domain containing 16
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000367912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022114.2-2173s21c1
Sequence:CCGGCCATTGCCGAGAAGTACTTTGCTCGAGCAAAGTACTTCTCGGCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022114.2-3274s21c1
Sequence:CCGGACGAGAAAGAAGACTCTTATTCTCGAGAATAAGAGTCTTCTTTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367875    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022114.2-4361s21c1
Sequence:CCGGATTGACTGCAGAGTCTATTTACTCGAGTAAATAGACTCTGCAGTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022114.2-3318s1c1
Sequence:CCGGGCCAATAGTGAGATGAACCAACTCGAGTTGGTTCATCTCACTATTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022114.2-2315s1c1
Sequence:CCGGCGCCCACAACTTGCTGGTCAACTCGAGTTGACCAGCAAGTTGTGGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020048    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022114.2-1246s1c1
Sequence:CCGGGCACGGTGAAGCCTTTCATATCTCGAGATATGAAAGGCTTCACCGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022114.2-122s1c1
Sequence:CCGGCGGTGACGTTGTAAATAATATCTCGAGATATTATTTACAACGTCACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022114.2-3759s1c1
Sequence:CCGGCAGGCTAAGAACCAGGCATATCTCGAGATATGCCTGGTTCTTAGCCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027504
PRDM16 MISSION shRNA Bacterial Glycerol Stock
PR domain containing 16
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000075458    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027504.2-4157s1c1
Sequence:CCGGGCATGGTATGAAAGAGGAAATCTCGAGATTTCCTCTTTCATACCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027504.2-214s1c1
Sequence:CCGGGCTCCTGTCTACATTCCTGAACTCGAGTTCAGGAATGTAGACAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027504.2-3644s1c1
Sequence:CCGGCCACCTTAGATTCTGAGGTTTCTCGAGAAACCTCAGAATCTAAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027504.2-2564s1c1
Sequence:CCGGCCTTGCATTATGCTAAGCCTTCTCGAGAAGGCTTAGCATAATGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027504.2-1175s1c1
Sequence:CCGGGCACGGTGAAGCCATTCATATCTCGAGATATGAATGGCTTCACCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027504
PRDM16 MISSION shRNA shRNA Plasmid DNA
PR domain containing 16
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000075458    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027504.2-4157s1c1
Sequence:CCGGGCATGGTATGAAAGAGGAAATCTCGAGATTTCCTCTTTCATACCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027504.2-214s1c1
Sequence:CCGGGCTCCTGTCTACATTCCTGAACTCGAGTTCAGGAATGTAGACAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027504.2-3644s1c1
Sequence:CCGGCCACCTTAGATTCTGAGGTTTCTCGAGAAACCTCAGAATCTAAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027504.2-2564s1c1
Sequence:CCGGCCTTGCATTATGCTAAGCCTTCTCGAGAAGGCTTAGCATAATGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027504.2-1175s1c1
Sequence:CCGGGCACGGTGAAGCCATTCATATCTCGAGATATGAATGGCTTCACCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027504
PRDM16 MISSION shRNA Lentiviral Transduction Particles
PR domain containing 16
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000075458    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027504.2-4157s1c1
Sequence:CCGGGCATGGTATGAAAGAGGAAATCTCGAGATTTCCTCTTTCATACCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027504.2-214s1c1
Sequence:CCGGGCTCCTGTCTACATTCCTGAACTCGAGTTCAGGAATGTAGACAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027504.2-3644s1c1
Sequence:CCGGCCACCTTAGATTCTGAGGTTTCTCGAGAAACCTCAGAATCTAAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027504.2-2564s1c1
Sequence:CCGGCCTTGCATTATGCTAAGCCTTCTCGAGAAGGCTTAGCATAATGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027504.2-1175s1c1
Sequence:CCGGGCACGGTGAAGCCATTCATATCTCGAGATATGAATGGCTTCACCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks