EMAIL THIS PAGE TO A FRIEND

PRDX3

peroxiredoxin 3

Synonyms: AOP-1 AOP1 HBC189 MER5 PRO1748 SP-22 prx-III
Gene ID:
Human(10935) Summary: This gene encodes a protein with antioxidant function and is localized in the mitochondrion. This gene shows significant nucleotide sequence similarity to the gene coding for the C22 subunit of Salmonella typhimurium alkylhydroperoxide reductase. Expression of this gene product in E. coli deficient in the C22-subunit gene rescued resistance of the bacteria to alkylhydroperoxide. The human and mouse genes are highly conserved, and they map to the regions syntenic between mouse and human chromosomes. Sequence comparisons with recently cloned mammalian homologues suggest that these genes consist of a family that is responsible for regulation of cellular proliferation, differentiation, and antioxidant functions. Two transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(11757) peroxiredoxin 3
Rat(64371) peroxiredoxin 3
Zebrafish(373079) peroxiredoxin 3
chicken(428986) peroxiredoxin 3
domestic cat(101088618) peroxiredoxin 3
dog(477839) peroxiredoxin 3
cow(281998) peroxiredoxin 3
sheep(101106731) peroxiredoxin 3
naked mole-rat(101719189) peroxiredoxin 3
103 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007452 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007452 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007452 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006793 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006793 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006793 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006793 Rosetta Predictions human pricing
NM_014098 Rosetta Predictions human pricing
NM_022540 Rosetta Predictions rat pricing
NM_007452 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006793 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00141994 predicted 807
2 SASI_Hs01_00141995 predicted 1111
3 SASI_Hs01_00141996 predicted 577
4 SASI_Hs01_00141997 predicted 530
5 SASI_Hs02_00342310 predicted 525
6 SASI_Hs01_00141998 predicted 450
7 SASI_Hs01_00141999 predicted 514
8 SASI_Hs01_00142000 predicted 580
9 SASI_Hs01_00142001 predicted 580
10 SASI_Hs01_00142002 predicted 542
11 SASI_Hs01_00142003 predicted 917
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014098 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00087579 predicted 748
2 SASI_Hs01_00087580 predicted 1052
3 SASI_Hs01_00087581 predicted 527
4 SASI_Hs01_00087582 predicted 482
5 SASI_Hs02_00345113 predicted 472
6 SASI_Hs01_00087583 predicted 400
7 SASI_Hs01_00087584 predicted 461
8 SASI_Hs01_00087585 predicted 529
9 SASI_Hs01_00087586 predicted 530
10 SASI_Hs01_00087587 predicted 488
11 SASI_Hs01_00087588 predicted 869
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022540 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00112423 predicted 476
2 SASI_Rn02_00263305 predicted 370
3 SASI_Rn01_00112424 predicted 538
4 SASI_Rn01_00112425 predicted 441
5 SASI_Rn01_00112426 predicted 511
6 SASI_Rn01_00112427 predicted 549
7 SASI_Rn02_00263306 predicted 586
8 SASI_Rn01_00112428 predicted 408
9 SASI_Rn01_00112429 predicted 597
10 SASI_Rn01_00112430 predicted 864
11 SASI_Rn01_00112431 predicted 905
12 SASI_Rn01_00112432 predicted 880
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007452 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00109892 predicted 589
2 SASI_Mm01_00109893 predicted 699
3 SASI_Mm01_00109894 predicted 489
4 SASI_Mm01_00109895 predicted 374
5 SASI_Mm02_00311638 predicted 209
6 SASI_Mm02_00311639 predicted 450
7 SASI_Mm01_00109898 predicted 383
8 SASI_Mm01_00109899 predicted 577
9 SASI_Mm01_00109901 predicted 426
10 SASI_Mm02_00311640 predicted 557
11 SASI_Mm01_00109896 predicted 886
12 SASI_Mm01_00109897 predicted 532
13 SASI_Mm01_00109900 predicted 464
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007452
VALIDATED
PRDX3 MISSION shRNA Bacterial Glycerol Stock
peroxiredoxin 3
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000417592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007452.2-630s21c1
Sequence:CCGGCTCTTCATTATTGACCCTAATCTCGAGATTAGGGTCAATAATGAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414225    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007452.2-1233s21c1
Sequence:CCGGGCTTCTGATCAAGGTCCTAAACTCGAGTTTAGGACCTTGATCAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120672    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007452.1-953s1c1
Sequence:CCGGCCACAGGCTTTGTAATTCTAACTCGAGTTAGAATTACAAAGCCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120676    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007452.1-405s1c1
Sequence:CCGGGCCAATGAATTTCATGATGTACTCGAGTACATCATGAAATTCATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120673    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007452.1-535s1c1
Sequence:CCGGCGGATATAACTAAGCAGATATCTCGAGATATCTGCTTAGTTATATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007452.1-822s1c1
Sequence:CCGGGCCATCCTATGTCTGCAATTACTCGAGTAATTGCAGACATAGGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120674    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007452.1-512s1c1
Sequence:CCGGCCACATGAACATCACACTGTTCTCGAGAACAGTGTGATGTTCATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007452
VALIDATED
PRDX3 MISSION shRNA shRNA Plasmid DNA
peroxiredoxin 3
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000417592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007452.2-630s21c1
Sequence:CCGGCTCTTCATTATTGACCCTAATCTCGAGATTAGGGTCAATAATGAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414225    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007452.2-1233s21c1
Sequence:CCGGGCTTCTGATCAAGGTCCTAAACTCGAGTTTAGGACCTTGATCAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120672    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007452.1-953s1c1
Sequence:CCGGCCACAGGCTTTGTAATTCTAACTCGAGTTAGAATTACAAAGCCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120676    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007452.1-405s1c1
Sequence:CCGGGCCAATGAATTTCATGATGTACTCGAGTACATCATGAAATTCATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120673    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007452.1-535s1c1
Sequence:CCGGCGGATATAACTAAGCAGATATCTCGAGATATCTGCTTAGTTATATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007452.1-822s1c1
Sequence:CCGGGCCATCCTATGTCTGCAATTACTCGAGTAATTGCAGACATAGGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120674    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007452.1-512s1c1
Sequence:CCGGCCACATGAACATCACACTGTTCTCGAGAACAGTGTGATGTTCATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007452
VALIDATED
PRDX3 MISSION shRNA Lentiviral Transduction Particles
peroxiredoxin 3
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000417592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007452.2-630s21c1
Sequence:CCGGCTCTTCATTATTGACCCTAATCTCGAGATTAGGGTCAATAATGAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414225    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007452.2-1233s21c1
Sequence:CCGGGCTTCTGATCAAGGTCCTAAACTCGAGTTTAGGACCTTGATCAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120672    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007452.1-953s1c1
Sequence:CCGGCCACAGGCTTTGTAATTCTAACTCGAGTTAGAATTACAAAGCCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120676    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007452.1-405s1c1
Sequence:CCGGGCCAATGAATTTCATGATGTACTCGAGTACATCATGAAATTCATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120673    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007452.1-535s1c1
Sequence:CCGGCGGATATAACTAAGCAGATATCTCGAGATATCTGCTTAGTTATATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007452.1-822s1c1
Sequence:CCGGGCCATCCTATGTCTGCAATTACTCGAGTAATTGCAGACATAGGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120674    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007452.1-512s1c1
Sequence:CCGGCCACATGAACATCACACTGTTCTCGAGAACAGTGTGATGTTCATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006793
VALIDATED
PRDX3 MISSION shRNA Bacterial Glycerol Stock
peroxiredoxin 3
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000286360    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_006793.2-526s21c1
Sequence:CCGGGTCAGACTTAACTAAGCAGATCTCGAGATCTGCTTAGTTAAGTCTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286361    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_006793.2-295s21c1
Sequence:CCGGCCTAAGCCTTGATGACTTTAACTCGAGTTAAAGTCATCAAGGCTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293792    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_006793.2-389s21c1
Sequence:CCGGAGTGACAAAGCTAACGAATTTCTCGAGAAATTCGTTAGCTTTGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293831    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_006793.2-1307s21c1
Sequence:CCGGAGCAAATGTGAATCGTATTATCTCGAGATAATACGATTCACATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_006793.2-83s21c1
Sequence:CCGGGCCCGACATGTGAGTGCCATTCTCGAGAATGGCACTCACATGTCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A3
TRC Version: 1 Clone ID:NM_006793.2-469s1c1
Sequence:CCGGCTGGATAAATACACCAAGGAACTCGAGTTCCTTGGTGTATTTATCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064840    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_006793.2-295s1c1
Sequence:CCGGCCTAAGCCTTGATGACTTTAACTCGAGTTAAAGTCATCAAGGCTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_006793.2-526s1c1
Sequence:CCGGGTCAGACTTAACTAAGCAGATCTCGAGATCTGCTTAGTTAAGTCTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006793
VALIDATED
PRDX3 MISSION shRNA shRNA Plasmid DNA
peroxiredoxin 3
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000286360    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_006793.2-526s21c1
Sequence:CCGGGTCAGACTTAACTAAGCAGATCTCGAGATCTGCTTAGTTAAGTCTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286361    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_006793.2-295s21c1
Sequence:CCGGCCTAAGCCTTGATGACTTTAACTCGAGTTAAAGTCATCAAGGCTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293792    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_006793.2-389s21c1
Sequence:CCGGAGTGACAAAGCTAACGAATTTCTCGAGAAATTCGTTAGCTTTGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293831    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_006793.2-1307s21c1
Sequence:CCGGAGCAAATGTGAATCGTATTATCTCGAGATAATACGATTCACATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_006793.2-83s21c1
Sequence:CCGGGCCCGACATGTGAGTGCCATTCTCGAGAATGGCACTCACATGTCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A3
TRC Version: 1 Clone ID:NM_006793.2-469s1c1
Sequence:CCGGCTGGATAAATACACCAAGGAACTCGAGTTCCTTGGTGTATTTATCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064840    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_006793.2-295s1c1
Sequence:CCGGCCTAAGCCTTGATGACTTTAACTCGAGTTAAAGTCATCAAGGCTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_006793.2-526s1c1
Sequence:CCGGGTCAGACTTAACTAAGCAGATCTCGAGATCTGCTTAGTTAAGTCTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006793
VALIDATED
PRDX3 MISSION shRNA Lentiviral Transduction Particles
peroxiredoxin 3
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000286360    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_006793.2-526s21c1
Sequence:CCGGGTCAGACTTAACTAAGCAGATCTCGAGATCTGCTTAGTTAAGTCTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286361    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_006793.2-295s21c1
Sequence:CCGGCCTAAGCCTTGATGACTTTAACTCGAGTTAAAGTCATCAAGGCTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293792    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_006793.2-389s21c1
Sequence:CCGGAGTGACAAAGCTAACGAATTTCTCGAGAAATTCGTTAGCTTTGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293831    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_006793.2-1307s21c1
Sequence:CCGGAGCAAATGTGAATCGTATTATCTCGAGATAATACGATTCACATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_006793.2-83s21c1
Sequence:CCGGGCCCGACATGTGAGTGCCATTCTCGAGAATGGCACTCACATGTCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A3
TRC Version: 1 Clone ID:NM_006793.2-469s1c1
Sequence:CCGGCTGGATAAATACACCAAGGAACTCGAGTTCCTTGGTGTATTTATCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064840    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_006793.2-295s1c1
Sequence:CCGGCCTAAGCCTTGATGACTTTAACTCGAGTTAAAGTCATCAAGGCTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_006793.2-526s1c1
Sequence:CCGGGTCAGACTTAACTAAGCAGATCTCGAGATCTGCTTAGTTAAGTCTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks