EMAIL THIS PAGE TO A FRIEND

PRDX6

peroxiredoxin 6

Synonyms: 1-Cys AOP2 NSGPx PRX aiPLA2 p29
UniProtKB ID: P30041, A8JZY7, P32077, Q5TAH4, Q5ZEZ8
Gene ID:
Human(9588) Summary: The protein encoded by this gene is a member of the thiol-specific antioxidant protein family. This protein is a bifunctional enzyme with two distinct active sites. It is involved in redox regulation of the cell; it can reduce H(2)O(2) and short chain organic, fatty acid, and phospholipid hydroperoxides. It may play a role in the regulation of phospholipid turnover as well as in protection against oxidative injury. [provided by RefSeq, Jul 2008]
Mouse(11758) peroxiredoxin 6
Rat(94167) peroxiredoxin 6
naked mole-rat(101696758) peroxiredoxin 6
cow(282438) peroxiredoxin 6
sheep(101112748) peroxiredoxin 6
Zebrafish(393778) peroxiredoxin 6
chicken(429062) peroxiredoxin 6
domestic cat(101092729) peroxiredoxin 6
dog(480069) peroxiredoxin 6
58 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007453 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007453 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007453 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004905 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004905 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004905 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004905 Rosetta Predictions human pricing
NM_053576 Rosetta Predictions rat pricing
NM_007453 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004905 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00338555 predicted 219
2 SASI_Hs01_00182363 predicted 246
3 SASI_Hs01_00182364 predicted 342
4 SASI_Hs01_00182365 predicted 653
5 SASI_Hs01_00182366 predicted 525
6 SASI_Hs01_00182368 predicted 683
7 SASI_Hs01_00182369 predicted 708
8 SASI_Hs02_00338556 predicted 735
9 SASI_Hs01_00182370 predicted 834
10 SASI_Hs01_00182371 predicted 499
11 SASI_Hs01_00182362 predicted 238
12 SASI_Hs01_00182367 predicted 497
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053576 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00038972 predicted 266
2 SASI_Rn01_00038977 predicted 197
3 SASI_Rn01_00038978 predicted 219
4 SASI_Rn01_00038979 predicted 399
5 SASI_Rn01_00038980 predicted 343
6 SASI_Rn02_00266239 predicted 321
7 SASI_Rn02_00266240 predicted 307
8 SASI_Rn02_00266241 predicted 260
9 SASI_Rn02_00266242 predicted 595
10 SASI_Rn02_00266243 predicted 481
11 SASI_Rn01_00038973 predicted 699
12 SASI_Rn01_00038974 predicted 679
13 SASI_Rn01_00038975 predicted 835
14 SASI_Rn01_00038976 predicted 778
15 SASI_Rn01_00038981 predicted 821
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007453 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00136163 predicted 710
2 SASI_Mm01_00136164 predicted 839
3 SASI_Mm01_00136165 predicted 247
4 SASI_Mm01_00136166 predicted 983
5 SASI_Mm01_00136167 predicted 808
6 SASI_Mm01_00136168 predicted 648
7 SASI_Mm01_00136169 predicted 317
8 SASI_Mm01_00136170 predicted 825
9 SASI_Mm01_00136171 predicted 849
10 SASI_Mm02_00311641 predicted 843
11 SASI_Mm01_00136172 predicted 662
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007453
VALIDATED
PRDX6 MISSION shRNA Bacterial Glycerol Stock
peroxiredoxin 6
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000101380    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007453.2-974s1c1
Sequence:CCGGGCTCTCTTTGAAACGAATTATCTCGAGATAATTCGTTTCAAAGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007453.2-411s1c1
Sequence:CCGGCGAGAAGGACGCTAACAACATCTCGAGATGTTGTTAGCGTCCTTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007453.2-657s1c1
Sequence:CCGGCCCTAAAGGAGTCTTCACCAACTCGAGTTGGTGAAGACTCCTTTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101382    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007453.2-632s1c1
Sequence:CCGGCCGAAGAGGAAGCCAAACAATCTCGAGATTGTTTGGCTTCCTCTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101381    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007453.2-259s1c1
Sequence:CCGGGCTCTTTCAATAGACAGTGTTCTCGAGAACACTGTCTATTGAAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000354239    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007453.3-973s21c1
Sequence:CCGGGCTCTCTTTGAAACGAATTATCTCGAGATAATTCGTTTCAAAGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326931    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007453.3-656s21c1
Sequence:CCGGCCCTAAAGGAGTCTTCACCAACTCGAGTTGGTGAAGACTCCTTTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326933    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007453.3-631s21c1
Sequence:CCGGCCGAAGAGGAAGCCAAACAATCTCGAGATTGTTTGGCTTCCTCTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007453.3-258s21c1
Sequence:CCGGGCTCTTTCAATAGACAGTGTTCTCGAGAACACTGTCTATTGAAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007453
VALIDATED
PRDX6 MISSION shRNA shRNA Plasmid DNA
peroxiredoxin 6
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000101380    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007453.2-974s1c1
Sequence:CCGGGCTCTCTTTGAAACGAATTATCTCGAGATAATTCGTTTCAAAGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007453.2-411s1c1
Sequence:CCGGCGAGAAGGACGCTAACAACATCTCGAGATGTTGTTAGCGTCCTTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007453.2-657s1c1
Sequence:CCGGCCCTAAAGGAGTCTTCACCAACTCGAGTTGGTGAAGACTCCTTTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101382    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007453.2-632s1c1
Sequence:CCGGCCGAAGAGGAAGCCAAACAATCTCGAGATTGTTTGGCTTCCTCTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101381    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007453.2-259s1c1
Sequence:CCGGGCTCTTTCAATAGACAGTGTTCTCGAGAACACTGTCTATTGAAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000354239    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007453.3-973s21c1
Sequence:CCGGGCTCTCTTTGAAACGAATTATCTCGAGATAATTCGTTTCAAAGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326931    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007453.3-656s21c1
Sequence:CCGGCCCTAAAGGAGTCTTCACCAACTCGAGTTGGTGAAGACTCCTTTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326933    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007453.3-631s21c1
Sequence:CCGGCCGAAGAGGAAGCCAAACAATCTCGAGATTGTTTGGCTTCCTCTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007453.3-258s21c1
Sequence:CCGGGCTCTTTCAATAGACAGTGTTCTCGAGAACACTGTCTATTGAAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007453
VALIDATED
PRDX6 MISSION shRNA Lentiviral Transduction Particles
peroxiredoxin 6
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000101380    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007453.2-974s1c1
Sequence:CCGGGCTCTCTTTGAAACGAATTATCTCGAGATAATTCGTTTCAAAGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007453.2-411s1c1
Sequence:CCGGCGAGAAGGACGCTAACAACATCTCGAGATGTTGTTAGCGTCCTTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007453.2-657s1c1
Sequence:CCGGCCCTAAAGGAGTCTTCACCAACTCGAGTTGGTGAAGACTCCTTTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101382    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007453.2-632s1c1
Sequence:CCGGCCGAAGAGGAAGCCAAACAATCTCGAGATTGTTTGGCTTCCTCTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101381    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007453.2-259s1c1
Sequence:CCGGGCTCTTTCAATAGACAGTGTTCTCGAGAACACTGTCTATTGAAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000354239    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007453.3-973s21c1
Sequence:CCGGGCTCTCTTTGAAACGAATTATCTCGAGATAATTCGTTTCAAAGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326931    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007453.3-656s21c1
Sequence:CCGGCCCTAAAGGAGTCTTCACCAACTCGAGTTGGTGAAGACTCCTTTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326933    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007453.3-631s21c1
Sequence:CCGGCCGAAGAGGAAGCCAAACAATCTCGAGATTGTTTGGCTTCCTCTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007453.3-258s21c1
Sequence:CCGGGCTCTTTCAATAGACAGTGTTCTCGAGAACACTGTCTATTGAAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004905
VALIDATED
PRDX6 MISSION shRNA Bacterial Glycerol Stock
peroxiredoxin 6
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000052153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004905.2-352s1c1
Sequence:CCGGCCCATCATCGATGATAGGAATCTCGAGATTCCTATCATCGATGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_004905.2-658s1c1
Sequence:CCGGCCGAAAGGAGTCTTCACCAAACTCGAGTTTGGTGAAGACTCCTTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052157    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_004905.2-271s1c1
Sequence:CCGGGACAGTGTTGAGGACCATCTTCTCGAGAAGATGGTCCTCAACACTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004905.2-462s1c1
Sequence:CCGGTGGTCCTGATAAGAAGCTGAACTCGAGTTCAGCTTCTTATCAGGACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052155    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_004905.2-115s1c1
Sequence:CCGGCGCATCCGTTTCCACGACTTTCTCGAGAAAGTCGTGGAAACGGATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004905
VALIDATED
PRDX6 MISSION shRNA shRNA Plasmid DNA
peroxiredoxin 6
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000052153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004905.2-352s1c1
Sequence:CCGGCCCATCATCGATGATAGGAATCTCGAGATTCCTATCATCGATGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_004905.2-658s1c1
Sequence:CCGGCCGAAAGGAGTCTTCACCAAACTCGAGTTTGGTGAAGACTCCTTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052157    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_004905.2-271s1c1
Sequence:CCGGGACAGTGTTGAGGACCATCTTCTCGAGAAGATGGTCCTCAACACTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004905.2-462s1c1
Sequence:CCGGTGGTCCTGATAAGAAGCTGAACTCGAGTTCAGCTTCTTATCAGGACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052155    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_004905.2-115s1c1
Sequence:CCGGCGCATCCGTTTCCACGACTTTCTCGAGAAAGTCGTGGAAACGGATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004905
VALIDATED
PRDX6 MISSION shRNA Lentiviral Transduction Particles
peroxiredoxin 6
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000052153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004905.2-352s1c1
Sequence:CCGGCCCATCATCGATGATAGGAATCTCGAGATTCCTATCATCGATGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_004905.2-658s1c1
Sequence:CCGGCCGAAAGGAGTCTTCACCAAACTCGAGTTTGGTGAAGACTCCTTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052157    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_004905.2-271s1c1
Sequence:CCGGGACAGTGTTGAGGACCATCTTCTCGAGAAGATGGTCCTCAACACTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004905.2-462s1c1
Sequence:CCGGTGGTCCTGATAAGAAGCTGAACTCGAGTTCAGCTTCTTATCAGGACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052155    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_004905.2-115s1c1
Sequence:CCGGCGCATCCGTTTCCACGACTTTCTCGAGAAAGTCGTGGAAACGGATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks