EMAIL THIS PAGE TO A FRIEND

PREPL

prolyl endopeptidase-like

Gene ID:
Human(9581) Summary: The protein encoded by this gene belongs to the prolyl oligopeptidase subfamily of serine peptidases. Mutations in this gene have been associated with hypotonia-cystinuria syndrome, also known as the 2p21 deletion syndrome. Several alternatively spliced transcript variants encoding either the same or different isoforms have been described for this gene.[provided by RefSeq, Jan 2010]
Mouse(213760) prolyl endopeptidase-like
Rat(298771) prolyl endopeptidase-like
Zebrafish(796680) prolyl endopeptidase-like
dog(474574) prolyl endopeptidase-like
domestic cat(101099793) prolyl endopeptidase-like
Horse(100053492) prolyl endopeptidase-like
chicken(421405) prolyl endopeptidase-like
cow(533479) prolyl endopeptidase-like
sheep(101111355) prolyl endopeptidase-like
domestic guinea pig(100719521) prolyl endopeptidase-like
naked mole-rat(101726210) prolyl endopeptidase-like
Domestic Rabbit(100356017) prolyl endopeptidase-like
125 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145984 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145984 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145984 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006036 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006036 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006036 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001042385 Rosetta Predictions human pricing
NM_001042386 Rosetta Predictions human pricing
NM_006036 siRNAs that have been validated in the lab human pricing
NM_001010951 Rosetta Predictions rat pricing
NM_145984 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042385 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00309388 predicted 1743
2 SASI_Hs02_00309389 predicted 1668
3 SASI_Hs02_00309390 predicted 1805
4 SASI_Hs02_00309391 predicted 1447
5 SASI_Hs02_00309392 predicted 1587
6 SASI_Hs02_00309393 predicted 408
7 SASI_Hs02_00309394 predicted 1468
8 SASI_Hs02_00309395 predicted 199
9 SASI_Hs02_00309396 predicted 1780
10 SASI_Hs02_00309397 predicted 484
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042386 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00309398 predicted 1727
2 SASI_Hs02_00309399 predicted 1654
3 SASI_Hs02_00309400 predicted 1791
4 SASI_Hs02_00309401 predicted 1433
5 SASI_Hs02_00309402 predicted 1576
6 SASI_Hs02_00309403 predicted 402
7 SASI_Hs02_00309404 predicted 1451
8 SASI_Hs02_00309405 predicted 202
9 SASI_Hs02_00309406 predicted 1769
10 SASI_Hs02_00309407 predicted 489
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006036 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00246841 validated 1925
1 SASI_Hs01_00246842 validated 1859
1 SASI_Hs01_00246843 validated 2261
2 SASI_Hs02_00340772 predicted 1994
3 SASI_Hs01_00246844 predicted 1632
4 SASI_Hs01_00246850 predicted 1778
5 SASI_Hs02_00340773 predicted 405
6 SASI_Hs02_00340774 predicted 1655
7 SASI_Hs02_00340775 predicted 201
8 SASI_Hs02_00340776 predicted 1959
9 SASI_Hs02_00340777 predicted 488
10 SASI_Hs01_00246845 predicted 983
11 SASI_Hs01_00246846 predicted 2053
12 SASI_Hs01_00246847 predicted 2370
13 SASI_Hs01_00246848 predicted 2904
14 SASI_Hs01_00246849 predicted 1952
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001010951 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00068989 predicted 1487
2 SASI_Rn01_00068990 predicted 226
3 SASI_Rn01_00068991 predicted 1955
4 SASI_Rn01_00068993 predicted 1797
5 SASI_Rn01_00068994 predicted 1149
6 SASI_Rn01_00068995 predicted 1537
7 SASI_Rn01_00068997 predicted 1321
8 SASI_Rn01_00068998 predicted 995
9 SASI_Rn02_00199827 predicted 767
10 SASI_Rn02_00199828 predicted 790
11 SASI_Rn01_00068992 predicted 219
12 SASI_Rn01_00068996 predicted 1285
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145984 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00145706 predicted 875
2 SASI_Mm01_00145708 predicted 1012
3 SASI_Mm01_00145709 predicted 1242
4 SASI_Mm01_00145710 predicted 892
5 SASI_Mm01_00145711 predicted 1078
6 SASI_Mm01_00145712 predicted 1573
7 SASI_Mm01_00145713 predicted 858
8 SASI_Mm02_00341492 predicted 1945
9 SASI_Mm01_00145714 predicted 1395
10 SASI_Mm01_00145715 predicted 1479
11 SASI_Mm01_00145707 predicted 1492
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145984
VALIDATED
PREPL MISSION shRNA Bacterial Glycerol Stock
prolyl endopeptidase-like
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000349874    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145984.2-897s21c1
Sequence:CCGGCATCGAGATGATGAGTTATACCTCGAGGTATAACTCATCATCTCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145984.3-1207s21c1
Sequence:CCGGTTGGGCCTGTGGATTCATAATCTCGAGATTATGAATCCACAGGCCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312135    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145984.2-1581s21c1
Sequence:CCGGGCTGACTTAGTGGCTTGCATTCTCGAGAATGCAAGCCACTAAGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313071    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145984.2-2559s21c1
Sequence:CCGGAGGATAGCATTCTTCATATTTCTCGAGAAATATGAAGAATGCTATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313114    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145984.2-1158s21c1
Sequence:CCGGGGATTCATAATGGATACAAATCTCGAGATTTGTATCCATTATGAATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145984.2-1545s21c1
Sequence:CCGGGCCGATGGCCGACTAACTAAACTCGAGTTTAGTTAGTCGGCCATCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348566    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145984.3-2619s21c1
Sequence:CCGGGGATAGCATTCTTCATATTTACTCGAGTAAATATGAAGAATGCTATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145984.3-1335s21c1
Sequence:CCGGCTGGTCACGAAGATCCGATTACTCGAGTAATCGGATCTTCGTGACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145984.2-2016s1c1
Sequence:CCGGCCCAACATTATCCTAGATATTCTCGAGAATATCTAGGATAATGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033178    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145984.2-1875s1c1
Sequence:CCGGCCTCAGCATTATCCTTCAGTTCTCGAGAACTGAAGGATAATGCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145984.2-2144s1c1
Sequence:CCGGGCTGAAGAAATACCTAAAGTTCTCGAGAACTTTAGGTATTTCTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033175    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145984.2-1581s1c1
Sequence:CCGGGCTGACTTAGTGGCTTGCATTCTCGAGAATGCAAGCCACTAAGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145984
VALIDATED
PREPL MISSION shRNA shRNA Plasmid DNA
prolyl endopeptidase-like
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000349874    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145984.2-897s21c1
Sequence:CCGGCATCGAGATGATGAGTTATACCTCGAGGTATAACTCATCATCTCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145984.3-1207s21c1
Sequence:CCGGTTGGGCCTGTGGATTCATAATCTCGAGATTATGAATCCACAGGCCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312135    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145984.2-1581s21c1
Sequence:CCGGGCTGACTTAGTGGCTTGCATTCTCGAGAATGCAAGCCACTAAGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313071    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145984.2-2559s21c1
Sequence:CCGGAGGATAGCATTCTTCATATTTCTCGAGAAATATGAAGAATGCTATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313114    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145984.2-1158s21c1
Sequence:CCGGGGATTCATAATGGATACAAATCTCGAGATTTGTATCCATTATGAATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145984.2-1545s21c1
Sequence:CCGGGCCGATGGCCGACTAACTAAACTCGAGTTTAGTTAGTCGGCCATCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348566    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145984.3-2619s21c1
Sequence:CCGGGGATAGCATTCTTCATATTTACTCGAGTAAATATGAAGAATGCTATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145984.3-1335s21c1
Sequence:CCGGCTGGTCACGAAGATCCGATTACTCGAGTAATCGGATCTTCGTGACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145984.2-2016s1c1
Sequence:CCGGCCCAACATTATCCTAGATATTCTCGAGAATATCTAGGATAATGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033178    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145984.2-1875s1c1
Sequence:CCGGCCTCAGCATTATCCTTCAGTTCTCGAGAACTGAAGGATAATGCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145984.2-2144s1c1
Sequence:CCGGGCTGAAGAAATACCTAAAGTTCTCGAGAACTTTAGGTATTTCTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033175    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145984.2-1581s1c1
Sequence:CCGGGCTGACTTAGTGGCTTGCATTCTCGAGAATGCAAGCCACTAAGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145984
VALIDATED
PREPL MISSION shRNA Lentiviral Transduction Particles
prolyl endopeptidase-like
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000349874    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145984.2-897s21c1
Sequence:CCGGCATCGAGATGATGAGTTATACCTCGAGGTATAACTCATCATCTCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145984.3-1207s21c1
Sequence:CCGGTTGGGCCTGTGGATTCATAATCTCGAGATTATGAATCCACAGGCCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312135    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145984.2-1581s21c1
Sequence:CCGGGCTGACTTAGTGGCTTGCATTCTCGAGAATGCAAGCCACTAAGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313071    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145984.2-2559s21c1
Sequence:CCGGAGGATAGCATTCTTCATATTTCTCGAGAAATATGAAGAATGCTATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313114    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145984.2-1158s21c1
Sequence:CCGGGGATTCATAATGGATACAAATCTCGAGATTTGTATCCATTATGAATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145984.2-1545s21c1
Sequence:CCGGGCCGATGGCCGACTAACTAAACTCGAGTTTAGTTAGTCGGCCATCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348566    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145984.3-2619s21c1
Sequence:CCGGGGATAGCATTCTTCATATTTACTCGAGTAAATATGAAGAATGCTATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145984.3-1335s21c1
Sequence:CCGGCTGGTCACGAAGATCCGATTACTCGAGTAATCGGATCTTCGTGACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145984.2-2016s1c1
Sequence:CCGGCCCAACATTATCCTAGATATTCTCGAGAATATCTAGGATAATGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033178    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145984.2-1875s1c1
Sequence:CCGGCCTCAGCATTATCCTTCAGTTCTCGAGAACTGAAGGATAATGCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145984.2-2144s1c1
Sequence:CCGGGCTGAAGAAATACCTAAAGTTCTCGAGAACTTTAGGTATTTCTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033175    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145984.2-1581s1c1
Sequence:CCGGGCTGACTTAGTGGCTTGCATTCTCGAGAATGCAAGCCACTAAGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006036
VALIDATED
PREPL MISSION shRNA Bacterial Glycerol Stock
prolyl endopeptidase-like
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000183582    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006036.2-4786s1c1
Sequence:CCGGGCACAGCTAATAGAAGACAAACTCGAGTTTGTCTTCTATTAGCTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075253    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_006036.1-2661s1c1
Sequence:CCGGGCTTATACTATTCTCTCCATTCTCGAGAATGGAGAGAATAGTATAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006036.1-1914s1c1
Sequence:CCGGGCTGATTTAGAGGCTTGCATTCTCGAGAATGCAAGCCTCTAAATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006036.1-2373s1c1
Sequence:CCGGCCTGGAGGCAATCATGTAATTCTCGAGAATTACATGATTGCCTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075256    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_006036.1-1311s1c1
Sequence:CCGGCCTGCAATTATGAATTGGGATCTCGAGATCCCAATTCATAATTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006036.1-2109s1c1
Sequence:CCGGCCTCTGACATTAGAAGAATTACTCGAGTAATTCTTCTAATGTCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006036
VALIDATED
PREPL MISSION shRNA shRNA Plasmid DNA
prolyl endopeptidase-like
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000183582    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006036.2-4786s1c1
Sequence:CCGGGCACAGCTAATAGAAGACAAACTCGAGTTTGTCTTCTATTAGCTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075253    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_006036.1-2661s1c1
Sequence:CCGGGCTTATACTATTCTCTCCATTCTCGAGAATGGAGAGAATAGTATAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006036.1-1914s1c1
Sequence:CCGGGCTGATTTAGAGGCTTGCATTCTCGAGAATGCAAGCCTCTAAATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006036.1-2373s1c1
Sequence:CCGGCCTGGAGGCAATCATGTAATTCTCGAGAATTACATGATTGCCTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075256    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_006036.1-1311s1c1
Sequence:CCGGCCTGCAATTATGAATTGGGATCTCGAGATCCCAATTCATAATTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006036.1-2109s1c1
Sequence:CCGGCCTCTGACATTAGAAGAATTACTCGAGTAATTCTTCTAATGTCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006036
VALIDATED
PREPL MISSION shRNA Lentiviral Transduction Particles
prolyl endopeptidase-like
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000183582    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006036.2-4786s1c1
Sequence:CCGGGCACAGCTAATAGAAGACAAACTCGAGTTTGTCTTCTATTAGCTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075253    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_006036.1-2661s1c1
Sequence:CCGGGCTTATACTATTCTCTCCATTCTCGAGAATGGAGAGAATAGTATAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006036.1-1914s1c1
Sequence:CCGGGCTGATTTAGAGGCTTGCATTCTCGAGAATGCAAGCCTCTAAATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006036.1-2373s1c1
Sequence:CCGGCCTGGAGGCAATCATGTAATTCTCGAGAATTACATGATTGCCTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075256    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_006036.1-1311s1c1
Sequence:CCGGCCTGCAATTATGAATTGGGATCTCGAGATCCCAATTCATAATTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006036.1-2109s1c1
Sequence:CCGGCCTCTGACATTAGAAGAATTACTCGAGTAATTCTTCTAATGTCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks