EMAIL THIS PAGE TO A FRIEND

PRKAA1

protein kinase, AMP-activated, alpha 1 catalytic subunit

Synonyms: AMPK AMPKa1
Gene ID:
Human(5562) Summary: The protein encoded by this gene belongs to the ser/thr protein kinase family. It is the catalytic subunit of the 5'-prime-AMP-activated protein kinase (AMPK). AMPK is a cellular energy sensor conserved in all eukaryotic cells. The kinase activity of AMPK is activated by the stimuli that increase the cellular AMP/ATP ratio. AMPK regulates the activities of a number of key metabolic enzymes through phosphorylation. It protects cells from stresses that cause ATP depletion by switching off ATP-consuming biosynthetic pathways. Alternatively spliced transcript variants encoding distinct isoforms have been observed. [provided by RefSeq, Jul 2008]
Mouse(105787) protein kinase, AMP-activated, alpha 1 catalytic subunit
Rat(65248) protein kinase, AMP-activated, alpha 1 catalytic subunit
Zebrafish(100001198) protein kinase, AMP-activated, alpha 1 catalytic subunit
Horse(100009710) protein kinase, AMP-activated, alpha 1 catalytic subunit
domestic cat(101095885) protein kinase, AMP-activated, alpha 1 catalytic subunit
chicken(427185) protein kinase, AMP-activated, alpha 1 catalytic subunit
dog(479351) protein kinase, AMP-activated, alpha 1 catalytic subunit
naked mole-rat(101722998) protein kinase, AMP-activated, alpha 1 catalytic subunit
domestic guinea pig(100714483) protein kinase, AMP-activated, alpha 1 catalytic subunit
cow(540404) protein kinase, AMP-activated, alpha 1 catalytic subunit
sheep(100294665) protein kinase, AMP-activated, alpha 1 catalytic subunit
sheep(101103425) protein kinase, AMP-activated, alpha 1 catalytic subunit
185 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4502329 Anti-AMPK α antibody produced in rabbit affinity isolated antibody rat, mouse, human
immunohistochemistry, western blot pricing
SAB1306032 ANTI-AMPK ALPHA 1(C-TERMINAL) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse, human
western blot pricing
SAB4502330 Anti-AMPK1, C-Terminal antibody produced in rabbit affinity isolated antibody mouse, human, rat
immunohistochemistry, western blot pricing
SAB1302234 ANTI-MOUSE PRKAA1 (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse
western blot pricing
SAB4503754 Anti-phospho-AMPK α (pThr172) antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, immunohistochemistry, western blot pricing
SAB4504334 Anti-phospho-AMPK1 (pSer485) antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, immunohistochemistry, western blot pricing
SAB4300141 Anti-phospho-PRKAA1 (pSer487) antibody produced in rabbit affinity isolated antibody human
immunofluorescence, immunohistochemistry, western blot pricing
SAB4300402 Anti-PRKAA1 (Ab-487) antibody produced in rabbit affinity isolated antibody human
immunohistochemistry pricing
SAB1406293 Anti-PRKAA1 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
SAB1412357 ANTI-PRKAA1 antibody produced in mouse clone 3B6, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412385 ANTI-PRKAA1 antibody produced in mouse clone 4D8, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
AV53846 Anti-PRKAA1 antibody produced in rabbit affinity isolated antibody human, rabbit
western blot pricing
SAB2103747 Anti-PRKAA1 antibody produced in rabbit affinity isolated antibody zebrafish, canine, guinea pig, pig, bovine, human, rat, horse, mouse, sheep, rabbit
western blot pricing
SAB2107032 Anti-PRKAA1 antibody produced in rabbit affinity isolated antibody horse, mouse, sheep, human, guinea pig, rabbit
ELISA, western blot pricing
HPA064946 Anti-PRKAA1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
HPA035409 Anti-PRKAA1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing
SAB4300452 Anti-PRKAA1/PRKAA2 (Ab-174/172) antibody produced in rabbit affinity isolated antibody human, rat, mouse
immunofluorescence, immunohistochemistry, western blot pricing
WH0005562M1 Monoclonal Anti-PRKAA1 antibody produced in mouse clone 1G4, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1404236 Monoclonal Anti-PRKAA1 antibody produced in mouse clone 4D9, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
SAB5300401 Monoclonal Anti-PRKAA1 antibody produced in mouse clone 2B7, ascites fluid mouse, monkey, human, rat
ELISA, flow cytometry, immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006251 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006251 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006251 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_139298 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_139298 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_139298 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001013367 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001013367 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001013367 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006251 Rosetta Predictions human pricing
NM_206907 Rosetta Predictions human pricing
NM_019142 Rosetta Predictions rat pricing
NM_001013367 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006251 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00092446 predicted 1322
2 SASI_Hs01_00092447 predicted 1737
3 SASI_Hs02_00341188 predicted 1239
4 SASI_Hs01_00092448 predicted 1708
5 SASI_Hs01_00092451 predicted 1285
6 SASI_Hs01_00092452 predicted 1284
7 SASI_Hs02_00341189 predicted 1398
8 SASI_Hs01_00092453 predicted 1492
9 SASI_Hs01_00092454 predicted 1706
10 SASI_Hs01_00092455 predicted 793
11 SASI_Hs01_00092449 predicted 1764
12 SASI_Hs01_00092450 predicted 1736
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_206907 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00204198 predicted 1364
2 SASI_Hs01_00204199 predicted 1780
3 SASI_Hs02_00373594 predicted 1288
4 SASI_Hs01_00204200 predicted 1750
5 SASI_Hs01_00204203 predicted 1325
6 SASI_Hs01_00204204 predicted 1324
7 SASI_Hs02_00373595 predicted 1446
8 SASI_Hs01_00204205 predicted 1534
9 SASI_Hs01_00204206 predicted 1752
10 SASI_Hs01_00204207 predicted 840
11 SASI_Hs01_00204201 predicted 1811
12 SASI_Hs01_00204202 predicted 1791
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019142 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00261906 predicted 1253
2 SASI_Rn02_00261907 predicted 1380
3 SASI_Rn01_00074868 predicted 1370
4 SASI_Rn01_00074869 predicted 754
5 SASI_Rn01_00074870 predicted 757
6 SASI_Rn01_00074872 predicted 1388
7 SASI_Rn01_00074873 predicted 1349
8 SASI_Rn01_00074874 predicted 1340
9 SASI_Rn02_00261908 predicted 1282
10 SASI_Rn01_00074875 predicted 1019
11 SASI_Rn01_00074867 predicted 1098
12 SASI_Rn01_00074871 predicted 297
13 SASI_Rn01_00074876 predicted 532
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013367 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00132861 predicted 1703
2 SASI_Mm01_00132862 predicted 1410
3 SASI_Mm01_00132863 predicted 1743
4 SASI_Mm01_00132864 predicted 1479
5 SASI_Mm01_00132865 predicted 1388
6 SASI_Mm01_00132866 predicted 1372
7 SASI_Mm01_00132867 predicted 1282
8 SASI_Mm01_00132868 predicted 1410
9 SASI_Mm01_00132869 predicted 336
10 SASI_Mm02_00287173 predicted 1499
11 SASI_Mm01_00132860 predicted 1731
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006251
VALIDATED
PRKAA1 MISSION shRNA Bacterial Glycerol Stock
protein kinase, AMP-activated, alpha 1 catalytic subunit
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000199831    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006251.5-1579s1c1
Sequence:CCGGGTGACCTCACTTGACTCTTCTCTCGAGAGAAGAGTCAAGTGAGGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196831    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006251.5-4192s1c1
Sequence:CCGGGCACAGACAATTGCAGTAAATCTCGAGATTTACTGCAATTGTCTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196482    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006251.5-163s1c1
Sequence:CCGGGTAGCTGTGAAGATACTCAATCTCGAGATTGAGTATCTTCACAGCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006251.x-1106s1c1
Sequence:CCGGCCATCCTGAAAGAGTACCATTCTCGAGAATGGTACTCTTTCAGGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006251.x-889s1c1
Sequence:CCGGTGATTGATGATGAAGCCTTAACTCGAGTTAAGGCTTCATCATCAATCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000859    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006251.x-1611s1c1
Sequence:CCGGCCTGGAAGTCACACAATAGAACTCGAGTTCTATTGTGTGACTTCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006251.x-993s1c1
Sequence:CCGGGTTGCCTACCATCTCATAATACTCGAGTATTATGAGATGGTAGGCAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219691    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006251.5-1417s1c1
Sequence:CCGGCTACTGGATTTCCGTAGTATTCTCGAGAATACTACGGAAATCCAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219690    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006251.5-1311s1c1
Sequence:CCGGGAAGGTTGTAAACCCATATTACTCGAGTAATATGGGTTTACAACCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006251
VALIDATED
PRKAA1 MISSION shRNA shRNA Plasmid DNA
protein kinase, AMP-activated, alpha 1 catalytic subunit
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000199831    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006251.5-1579s1c1
Sequence:CCGGGTGACCTCACTTGACTCTTCTCTCGAGAGAAGAGTCAAGTGAGGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196831    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006251.5-4192s1c1
Sequence:CCGGGCACAGACAATTGCAGTAAATCTCGAGATTTACTGCAATTGTCTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196482    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006251.5-163s1c1
Sequence:CCGGGTAGCTGTGAAGATACTCAATCTCGAGATTGAGTATCTTCACAGCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006251.x-1106s1c1
Sequence:CCGGCCATCCTGAAAGAGTACCATTCTCGAGAATGGTACTCTTTCAGGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006251.x-889s1c1
Sequence:CCGGTGATTGATGATGAAGCCTTAACTCGAGTTAAGGCTTCATCATCAATCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000859    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006251.x-1611s1c1
Sequence:CCGGCCTGGAAGTCACACAATAGAACTCGAGTTCTATTGTGTGACTTCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006251.x-993s1c1
Sequence:CCGGGTTGCCTACCATCTCATAATACTCGAGTATTATGAGATGGTAGGCAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219691    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006251.5-1417s1c1
Sequence:CCGGCTACTGGATTTCCGTAGTATTCTCGAGAATACTACGGAAATCCAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219690    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006251.5-1311s1c1
Sequence:CCGGGAAGGTTGTAAACCCATATTACTCGAGTAATATGGGTTTACAACCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006251
VALIDATED
PRKAA1 MISSION shRNA Lentiviral Transduction Particles
protein kinase, AMP-activated, alpha 1 catalytic subunit
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000199831    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006251.5-1579s1c1
Sequence:CCGGGTGACCTCACTTGACTCTTCTCTCGAGAGAAGAGTCAAGTGAGGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196831    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006251.5-4192s1c1
Sequence:CCGGGCACAGACAATTGCAGTAAATCTCGAGATTTACTGCAATTGTCTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196482    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006251.5-163s1c1
Sequence:CCGGGTAGCTGTGAAGATACTCAATCTCGAGATTGAGTATCTTCACAGCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006251.x-1106s1c1
Sequence:CCGGCCATCCTGAAAGAGTACCATTCTCGAGAATGGTACTCTTTCAGGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006251.x-889s1c1
Sequence:CCGGTGATTGATGATGAAGCCTTAACTCGAGTTAAGGCTTCATCATCAATCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000859    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006251.x-1611s1c1
Sequence:CCGGCCTGGAAGTCACACAATAGAACTCGAGTTCTATTGTGTGACTTCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006251.x-993s1c1
Sequence:CCGGGTTGCCTACCATCTCATAATACTCGAGTATTATGAGATGGTAGGCAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219691    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006251.5-1417s1c1
Sequence:CCGGCTACTGGATTTCCGTAGTATTCTCGAGAATACTACGGAAATCCAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219690    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006251.5-1311s1c1
Sequence:CCGGGAAGGTTGTAAACCCATATTACTCGAGTAATATGGGTTTACAACCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_139298
PRKAA1 MISSION shRNA Bacterial Glycerol Stock
protein kinase, AMP-activated, alpha 1 catalytic subunit
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000023999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_139298.4-990s1c1
Sequence:CCGGCCCATCTTATAGTTCAACCATCTCGAGATGGTTGAACTATAAGATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_139298.4-1396s1c1
Sequence:CCGGGCAATCAAGCAGTTGGATTATCTCGAGATAATCCAACTGCTTGATTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_139298.4-213s1c1
Sequence:CCGGCCTGAATCGAAATGTGTTCTTCTCGAGAAGAACACATTTCGATTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_139298.4-1297s1c1
Sequence:CCGGCCACAGAAATCCAAACACCAACTCGAGTTGGTGTTTGGATTTCTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_139298.4-1540s1c1
Sequence:CCGGCGTAGTATTGATGATGAGATTCTCGAGAATCTCATCATCAATACTACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_139298
PRKAA1 MISSION shRNA shRNA Plasmid DNA
protein kinase, AMP-activated, alpha 1 catalytic subunit
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000023999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_139298.4-990s1c1
Sequence:CCGGCCCATCTTATAGTTCAACCATCTCGAGATGGTTGAACTATAAGATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_139298.4-1396s1c1
Sequence:CCGGGCAATCAAGCAGTTGGATTATCTCGAGATAATCCAACTGCTTGATTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_139298.4-213s1c1
Sequence:CCGGCCTGAATCGAAATGTGTTCTTCTCGAGAAGAACACATTTCGATTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_139298.4-1297s1c1
Sequence:CCGGCCACAGAAATCCAAACACCAACTCGAGTTGGTGTTTGGATTTCTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_139298.4-1540s1c1
Sequence:CCGGCGTAGTATTGATGATGAGATTCTCGAGAATCTCATCATCAATACTACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_139298
PRKAA1 MISSION shRNA Lentiviral Transduction Particles
protein kinase, AMP-activated, alpha 1 catalytic subunit
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000023999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_139298.4-990s1c1
Sequence:CCGGCCCATCTTATAGTTCAACCATCTCGAGATGGTTGAACTATAAGATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_139298.4-1396s1c1
Sequence:CCGGGCAATCAAGCAGTTGGATTATCTCGAGATAATCCAACTGCTTGATTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_139298.4-213s1c1
Sequence:CCGGCCTGAATCGAAATGTGTTCTTCTCGAGAAGAACACATTTCGATTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_139298.4-1297s1c1
Sequence:CCGGCCACAGAAATCCAAACACCAACTCGAGTTGGTGTTTGGATTTCTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_139298.4-1540s1c1
Sequence:CCGGCGTAGTATTGATGATGAGATTCTCGAGAATCTCATCATCAATACTACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001013367
PRKAA1 MISSION shRNA Bacterial Glycerol Stock
protein kinase, AMP-activated, alpha 1 catalytic subunit
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000360841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013367.3-1419s21c1
Sequence:CCGGTTGTTGGATTTCCGTAGTATTCTCGAGAATACTACGGAAATCCAACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360770    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001013367.3-2077s21c1
Sequence:CCGGGAATCCTCATAGACCTTATTACTCGAGTAATAAGGTCTATGAGGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360769    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001013367.3-1992s21c1
Sequence:CCGGGACCATAAATTTACCATAAAGCTCGAGCTTTATGGTAAATTTATGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013367.3-144s21c1
Sequence:CCGGCACGAGTTGACCGGACATAAACTCGAGTTTATGTCCGGTCAACTCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001013367
PRKAA1 MISSION shRNA shRNA Plasmid DNA
protein kinase, AMP-activated, alpha 1 catalytic subunit
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000360841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013367.3-1419s21c1
Sequence:CCGGTTGTTGGATTTCCGTAGTATTCTCGAGAATACTACGGAAATCCAACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360770    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001013367.3-2077s21c1
Sequence:CCGGGAATCCTCATAGACCTTATTACTCGAGTAATAAGGTCTATGAGGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360769    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001013367.3-1992s21c1
Sequence:CCGGGACCATAAATTTACCATAAAGCTCGAGCTTTATGGTAAATTTATGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013367.3-144s21c1
Sequence:CCGGCACGAGTTGACCGGACATAAACTCGAGTTTATGTCCGGTCAACTCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001013367
PRKAA1 MISSION shRNA Lentiviral Transduction Particles
protein kinase, AMP-activated, alpha 1 catalytic subunit
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000360841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013367.3-1419s21c1
Sequence:CCGGTTGTTGGATTTCCGTAGTATTCTCGAGAATACTACGGAAATCCAACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360770    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001013367.3-2077s21c1
Sequence:CCGGGAATCCTCATAGACCTTATTACTCGAGTAATAAGGTCTATGAGGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360769    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001013367.3-1992s21c1
Sequence:CCGGGACCATAAATTTACCATAAAGCTCGAGCTTTATGGTAAATTTATGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013367.3-144s21c1
Sequence:CCGGCACGAGTTGACCGGACATAAACTCGAGTTTATGTCCGGTCAACTCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks