EMAIL THIS PAGE TO A FRIEND

PRKCQ

protein kinase C, theta

Synonyms: PRKCT nPKC-theta
UniProtKB ID: Q04759, Q14DH6, Q3MJF1, Q64FY5, Q9H508, Q9H549
Gene ID:
Human(5588) Summary: Protein kinase C (PKC) is a family of serine- and threonine-specific protein kinases that can be activated by calcium and the second messenger diacylglycerol. PKC family members phosphorylate a wide variety of protein targets and are known to be involved in diverse cellular signaling pathways. PKC family members also serve as major receptors for phorbol esters, a class of tumor promoters. Each member of the PKC family has a specific expression profile and is believed to play a distinct role. The protein encoded by this gene is one of the PKC family members. It is a calcium-independent and phospholipid-dependent protein kinase. This kinase is important for T-cell activation. It is required for the activation of the transcription factors NF-kappaB and AP-1, and may link the T cell receptor (TCR) signaling complex to the activation of the transcription factors. [provided by RefSeq, Jul 2008]
Mouse(18761) protein kinase C, theta
Rat(85420) protein kinase C, theta
naked mole-rat(101724103) protein kinase C, theta
domestic guinea pig(100726308) protein kinase C, theta
cow(505901) protein kinase C, theta
sheep(101113426) protein kinase C, theta
Zebrafish(555521) protein kinase C, theta
domestic cat(101100730) protein kinase C, theta
Horse(100070207) protein kinase C, theta
dog(478013) protein kinase C, theta
chicken(776459) protein kinase C, theta
172 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1302538 ANTI-MOUSE PRKCQ (CENTER) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse
western blot pricing
SAB4504516 Anti-phospho-PKC θ (pSer676) antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, immunohistochemistry, western blot pricing
SAB4504100 Anti-phospho-PKC θ (pSer695) antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, western blot pricing
SAB4504060 Anti-phospho-PKC θ (pThr538) antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, western blot pricing
SAB4504099 Anti-phospho-PKC-pan (pThr497) antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunohistochemistry, western blot pricing
SAB4300236 Anti-phospho-PRKCQ (pSer676) antibody produced in rabbit affinity isolated antibody human, rat, mouse
immunofluorescence, immunohistochemistry, western blot pricing
SAB4300140 Anti-phospho-PRKCQ (pSer695) antibody produced in rabbit affinity isolated antibody human
immunohistochemistry pricing
SAB4502374 Anti-PKC THET antibody produced in rabbit affinity isolated antibody rat, mouse, human
immunohistochemistry, western blot pricing
SAB4502375 Anti-PKC THET, C-Terminal antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, western blot pricing
SAB1306355 ANTI-PKC THETA(C-TERMINAL) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
immunohistochemistry, western blot pricing
SAB4300540 Anti-PRKCQ (Ab-676) antibody produced in rabbit affinity isolated antibody human
immunofluorescence, immunohistochemistry, western blot pricing
SAB4300446 Anti-PRKCQ (Ab-695) antibody produced in rabbit affinity isolated antibody human
immunohistochemistry, western blot pricing
GW22473C Anti-PRKCQ antibody produced in chicken affinity isolated antibody, buffered aqueous solution rat, mouse, human
western blot pricing
SAB1401309 Anti-PRKCQ antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
western blot pricing
HPA065279 Anti-PRKCQ antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing
HPA073098 Anti-PRKCQ antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008859 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008859 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008859 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006257 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006257 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006257 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_178075 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178075 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178075 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006257 Rosetta Predictions human pricing
XM_001064068 Rosetta Predictions rat pricing
XM_001064127 Rosetta Predictions rat pricing
XM_001066028 Rosetta Predictions rat pricing
XM_341553 Rosetta Predictions rat pricing
NM_008859 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006257 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00239143 predicted 944
2 SASI_Hs01_00239144 predicted 972
3 SASI_Hs01_00239145 predicted 761
4 SASI_Hs01_00239147 predicted 1620
5 SASI_Hs02_00341200 predicted 1114
6 SASI_Hs02_00341201 predicted 391
7 SASI_Hs01_00239148 predicted 277
8 SASI_Hs01_00239149 predicted 985
9 SASI_Hs02_00341202 predicted 1920
10 SASI_Hs01_00239150 predicted 715
11 SASI_Hs01_00239146 predicted 391
12 SASI_Hs01_00239151 predicted 416
13 SASI_Hs01_00239152 predicted 1560
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001064068 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00309222 predicted 1040
2 SASI_Rn02_00309223 predicted 1604
3 SASI_Rn02_00309224 predicted 2042
4 SASI_Rn02_00309225 predicted 1729
5 SASI_Rn02_00309226 predicted 1006
6 SASI_Rn02_00309227 predicted 248
7 SASI_Rn02_00309228 predicted 435
8 SASI_Rn02_00309229 predicted 2034
9 SASI_Rn02_00309230 predicted 317
10 SASI_Rn02_00309231 predicted 295
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001064127 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00309397 predicted 2111
2 SASI_Rn02_00309398 predicted 1808
3 SASI_Rn02_00309399 predicted 1006
4 SASI_Rn02_00309400 predicted 1240
5 SASI_Rn02_00309401 predicted 1065
6 SASI_Rn02_00309402 predicted 252
7 SASI_Rn02_00309403 predicted 440
8 SASI_Rn02_00309404 predicted 2108
9 SASI_Rn02_00309405 predicted 319
10 SASI_Rn02_00309406 predicted 298
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001066028 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00316118 predicted 1036
2 SASI_Rn02_00316119 predicted 1605
3 SASI_Rn02_00316120 predicted 2040
4 SASI_Rn02_00316121 predicted 1729
5 SASI_Rn02_00316122 predicted 1007
6 SASI_Rn02_00316123 predicted 245
7 SASI_Rn02_00316124 predicted 435
8 SASI_Rn02_00316125 predicted 2034
9 SASI_Rn02_00316126 predicted 316
10 SASI_Rn02_00316127 predicted 295
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_341553 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00393089 predicted 2120
2 SASI_Rn02_00393090 predicted 1810
3 SASI_Rn02_00393091 predicted 1003
4 SASI_Rn02_00393092 predicted 1231
5 SASI_Rn02_00393093 predicted 1067
6 SASI_Rn02_00393094 predicted 248
7 SASI_Rn02_00393095 predicted 439
8 SASI_Rn02_00393096 predicted 2111
9 SASI_Rn02_00393097 predicted 321
10 SASI_Rn02_00393098 predicted 300
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008859 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00135080 predicted 402
2 SASI_Mm01_00135081 predicted 2057
3 SASI_Mm01_00135082 predicted 736
4 SASI_Mm01_00135083 predicted 1001
5 SASI_Mm01_00135084 predicted 308
6 SASI_Mm01_00135085 predicted 411
7 SASI_Mm01_00135086 predicted 377
8 SASI_Mm01_00135087 predicted 2046
9 SASI_Mm01_00135088 predicted 2103
10 SASI_Mm01_00135089 predicted 545
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008859
PRKCQ MISSION shRNA Bacterial Glycerol Stock
protein kinase C, theta
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000425425    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008859.2-1132s21c1
Sequence:CCGGCCCTTTGGATGGGTCAAATAACTCGAGTTATTTGACCCATCCAAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008859.2-852s21c1
Sequence:CCGGTGGCGAGGCAAGGACTCAAATCTCGAGATTTGAGTCCTTGCCTCGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374373    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008859.2-2454s21c1
Sequence:CCGGGCCCTTGAAGTTAGATCATTACTCGAGTAATGATCTAACTTCAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379017    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008859.2-1389s21c1
Sequence:CCGGTGGCATGGGAGCATCCATTTCCTCGAGGAAATGGATGCTCCCATGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365991    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008859.2-2411s21c1
Sequence:CCGGTAATGACATCATCCCGTTATACTCGAGTATAACGGGATGATGTCATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008859.2-1467s21c1
Sequence:CCGGATCTCAATGGAGGCGACTTAACTCGAGTTAAGTCGCCTCCATTGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008859.2-1021s21c1
Sequence:CCGGCCGAGAAGGCCCAGTTGAAATCTCGAGATTTCAACTGGGCCTTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008859
PRKCQ MISSION shRNA shRNA Plasmid DNA
protein kinase C, theta
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000425425    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008859.2-1132s21c1
Sequence:CCGGCCCTTTGGATGGGTCAAATAACTCGAGTTATTTGACCCATCCAAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008859.2-852s21c1
Sequence:CCGGTGGCGAGGCAAGGACTCAAATCTCGAGATTTGAGTCCTTGCCTCGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374373    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008859.2-2454s21c1
Sequence:CCGGGCCCTTGAAGTTAGATCATTACTCGAGTAATGATCTAACTTCAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379017    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008859.2-1389s21c1
Sequence:CCGGTGGCATGGGAGCATCCATTTCCTCGAGGAAATGGATGCTCCCATGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365991    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008859.2-2411s21c1
Sequence:CCGGTAATGACATCATCCCGTTATACTCGAGTATAACGGGATGATGTCATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008859.2-1467s21c1
Sequence:CCGGATCTCAATGGAGGCGACTTAACTCGAGTTAAGTCGCCTCCATTGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008859.2-1021s21c1
Sequence:CCGGCCGAGAAGGCCCAGTTGAAATCTCGAGATTTCAACTGGGCCTTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008859
PRKCQ MISSION shRNA Lentiviral Transduction Particles
protein kinase C, theta
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000425425    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008859.2-1132s21c1
Sequence:CCGGCCCTTTGGATGGGTCAAATAACTCGAGTTATTTGACCCATCCAAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008859.2-852s21c1
Sequence:CCGGTGGCGAGGCAAGGACTCAAATCTCGAGATTTGAGTCCTTGCCTCGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374373    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008859.2-2454s21c1
Sequence:CCGGGCCCTTGAAGTTAGATCATTACTCGAGTAATGATCTAACTTCAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379017    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008859.2-1389s21c1
Sequence:CCGGTGGCATGGGAGCATCCATTTCCTCGAGGAAATGGATGCTCCCATGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365991    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008859.2-2411s21c1
Sequence:CCGGTAATGACATCATCCCGTTATACTCGAGTATAACGGGATGATGTCATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008859.2-1467s21c1
Sequence:CCGGATCTCAATGGAGGCGACTTAACTCGAGTTAAGTCGCCTCCATTGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008859.2-1021s21c1
Sequence:CCGGCCGAGAAGGCCCAGTTGAAATCTCGAGATTTCAACTGGGCCTTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006257
VALIDATED
PRKCQ MISSION shRNA Bacterial Glycerol Stock
protein kinase C, theta
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000199654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A3
TRC Version: 1 Clone ID:NM_006257.2-140s1c1
Sequence:CCGGGCGAGGCTGTTAACCCTTACTCTCGAGAGTAAGGGTTAACAGCCTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A3
TRC Version: 1 Clone ID:NM_006257.2-198s1c1
Sequence:CCGGCGGGCAGATGTATATCCAGAACTCGAGTTCTGGATATACATCTGCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195559    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006257.2-2782s1c1
Sequence:CCGGCATCCTGATTGGGCATGAAATCTCGAGATTTCATGCCCAATCAGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006257.2-907s1c1
Sequence:CCGGGCCAACCTTTGTGGCATAAACCTCGAGGTTTATGCCACAAAGGTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197216    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A3
TRC Version: 1 Clone ID:NM_006257.2-1318s1c1
Sequence:CCGGGTGGTCTTGATGGACGATGATCTCGAGATCATCGTCCATCAAGACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A3
TRC Version: 1 Clone ID:NM_006257.x-1924s1c1
Sequence:CCGGCGGGAGATCAACTGGGAGGAACTCGAGTTCCTCCCAGTTGATCTCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A3
TRC Version: 1 Clone ID:NM_006257.x-355s1c1
Sequence:CCGGCAAGGCCGAATGCTAATGAATCTCGAGATTCATTAGCATTCGGCCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001793    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: A3
TRC Version: 1 Clone ID:NM_006257.x-2251s1c1
Sequence:CCGGCAATAAAGACTGAGACCCGTTCTCGAGAACGGGTCTCAGTCTTTATTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006257.x-1102s1c1
Sequence:CCGGGAACCTGAACTGAACAAAGAACTCGAGTTCTTTGTTCAGTTCAGGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006257.x-1428s1c1
Sequence:CCGGCATCCAAAGCTGCCACAAGTTCTCGAGAACTTGTGGCAGCTTTGGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006257
VALIDATED
PRKCQ MISSION shRNA shRNA Plasmid DNA
protein kinase C, theta
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000199654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A3
TRC Version: 1 Clone ID:NM_006257.2-140s1c1
Sequence:CCGGGCGAGGCTGTTAACCCTTACTCTCGAGAGTAAGGGTTAACAGCCTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A3
TRC Version: 1 Clone ID:NM_006257.2-198s1c1
Sequence:CCGGCGGGCAGATGTATATCCAGAACTCGAGTTCTGGATATACATCTGCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195559    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006257.2-2782s1c1
Sequence:CCGGCATCCTGATTGGGCATGAAATCTCGAGATTTCATGCCCAATCAGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006257.2-907s1c1
Sequence:CCGGGCCAACCTTTGTGGCATAAACCTCGAGGTTTATGCCACAAAGGTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197216    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A3
TRC Version: 1 Clone ID:NM_006257.2-1318s1c1
Sequence:CCGGGTGGTCTTGATGGACGATGATCTCGAGATCATCGTCCATCAAGACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A3
TRC Version: 1 Clone ID:NM_006257.x-1924s1c1
Sequence:CCGGCGGGAGATCAACTGGGAGGAACTCGAGTTCCTCCCAGTTGATCTCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A3
TRC Version: 1 Clone ID:NM_006257.x-355s1c1
Sequence:CCGGCAAGGCCGAATGCTAATGAATCTCGAGATTCATTAGCATTCGGCCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001793    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: A3
TRC Version: 1 Clone ID:NM_006257.x-2251s1c1
Sequence:CCGGCAATAAAGACTGAGACCCGTTCTCGAGAACGGGTCTCAGTCTTTATTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006257.x-1102s1c1
Sequence:CCGGGAACCTGAACTGAACAAAGAACTCGAGTTCTTTGTTCAGTTCAGGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006257.x-1428s1c1
Sequence:CCGGCATCCAAAGCTGCCACAAGTTCTCGAGAACTTGTGGCAGCTTTGGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006257
VALIDATED
PRKCQ MISSION shRNA Lentiviral Transduction Particles
protein kinase C, theta
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000199654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A3
TRC Version: 1 Clone ID:NM_006257.2-140s1c1
Sequence:CCGGGCGAGGCTGTTAACCCTTACTCTCGAGAGTAAGGGTTAACAGCCTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A3
TRC Version: 1 Clone ID:NM_006257.2-198s1c1
Sequence:CCGGCGGGCAGATGTATATCCAGAACTCGAGTTCTGGATATACATCTGCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195559    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006257.2-2782s1c1
Sequence:CCGGCATCCTGATTGGGCATGAAATCTCGAGATTTCATGCCCAATCAGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006257.2-907s1c1
Sequence:CCGGGCCAACCTTTGTGGCATAAACCTCGAGGTTTATGCCACAAAGGTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197216    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A3
TRC Version: 1 Clone ID:NM_006257.2-1318s1c1
Sequence:CCGGGTGGTCTTGATGGACGATGATCTCGAGATCATCGTCCATCAAGACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A3
TRC Version: 1 Clone ID:NM_006257.x-1924s1c1
Sequence:CCGGCGGGAGATCAACTGGGAGGAACTCGAGTTCCTCCCAGTTGATCTCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A3
TRC Version: 1 Clone ID:NM_006257.x-355s1c1
Sequence:CCGGCAAGGCCGAATGCTAATGAATCTCGAGATTCATTAGCATTCGGCCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001793    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: A3
TRC Version: 1 Clone ID:NM_006257.x-2251s1c1
Sequence:CCGGCAATAAAGACTGAGACCCGTTCTCGAGAACGGGTCTCAGTCTTTATTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006257.x-1102s1c1
Sequence:CCGGGAACCTGAACTGAACAAAGAACTCGAGTTCTTTGTTCAGTTCAGGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006257.x-1428s1c1
Sequence:CCGGCATCCAAAGCTGCCACAAGTTCTCGAGAACTTGTGGCAGCTTTGGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178075
VALIDATED
PRKCQ MISSION shRNA Bacterial Glycerol Stock
protein kinase C, theta
Mouse
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000022854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178075.2-929s1c1
Sequence:CCGGCGACAGTGTAATGCAGCGATTCTCGAGAATCGCTGCATTACACTGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_178075.2-1235s1c1
Sequence:CCGGGCGATGATTGAAAGCACCCAACTCGAGTTGGGTGCTTTCAATCATCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022858    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_178075.2-823s1c1
Sequence:CCGGCCATGTCAAGTGTCACGAGTTCTCGAGAACTCGTGACACTTGACATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178075
VALIDATED
PRKCQ MISSION shRNA shRNA Plasmid DNA
protein kinase C, theta
Mouse
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000022854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178075.2-929s1c1
Sequence:CCGGCGACAGTGTAATGCAGCGATTCTCGAGAATCGCTGCATTACACTGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_178075.2-1235s1c1
Sequence:CCGGGCGATGATTGAAAGCACCCAACTCGAGTTGGGTGCTTTCAATCATCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022858    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_178075.2-823s1c1
Sequence:CCGGCCATGTCAAGTGTCACGAGTTCTCGAGAACTCGTGACACTTGACATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178075
VALIDATED
PRKCQ MISSION shRNA Lentiviral Transduction Particles
protein kinase C, theta
Mouse
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000022854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178075.2-929s1c1
Sequence:CCGGCGACAGTGTAATGCAGCGATTCTCGAGAATCGCTGCATTACACTGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_178075.2-1235s1c1
Sequence:CCGGGCGATGATTGAAAGCACCCAACTCGAGTTGGGTGCTTTCAATCATCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022858    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_178075.2-823s1c1
Sequence:CCGGCCATGTCAAGTGTCACGAGTTCTCGAGAACTCGTGACACTTGACATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks