EMAIL THIS PAGE TO A FRIEND

PRKRA

protein kinase, interferon-inducible double stranded RNA dependent activator

Synonyms: DYT16 PACT RAX
UniProtKB ID: O75569, A8K3I6, Q53G24, Q6X7T5, Q8NDK4
Gene ID:
Human(8575) Summary: This gene encodes a protein kinase activated by double-stranded RNA which mediates the effects of interferon in response to viral infection. Mutations in this gene have been associated with dystonia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2008]
Mouse(23992) protein kinase, interferon inducible double stranded RNA dependent activator
Rat(311130) protein kinase, interferon inducible double stranded RNA dependent activator
Zebrafish(557370) protein kinase, interferon-inducible double stranded RNA dependent activator
domestic cat(101101495) protein kinase, interferon-inducible double stranded RNA dependent activator
dog(488423) protein kinase, interferon-inducible double stranded RNA dependent activator
cow(282875) protein kinase, interferon-inducible double stranded RNA dependent activator
sheep(101102289) protein kinase, interferon-inducible double stranded RNA dependent activator
domestic guinea pig(100727445) protein kinase, interferon-inducible double stranded RNA dependent activator
naked mole-rat(101703129) protein kinase, interferon-inducible double stranded RNA dependent activator
Gene Class: Apoptosis
116 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003690 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003690 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003690 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011871 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011871 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011871 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU145131 MISSION® esiRNA esiRNA human PRKRA (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003690 Rosetta Predictions human pricing
NM_001024780 Rosetta Predictions rat pricing
NM_011871 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003690 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00051857 predicted 1001
2 SASI_Hs01_00051858 predicted 238
3 SASI_Hs01_00051859 predicted 1041
4 SASI_Hs01_00051860 predicted 234
5 SASI_Hs01_00051861 predicted 693
6 SASI_Hs01_00051862 predicted 290
7 SASI_Hs02_00336113 predicted 569
8 SASI_Hs01_00051864 predicted 202
9 SASI_Hs01_00051865 predicted 667
10 SASI_Hs01_00051866 predicted 564
11 SASI_Hs01_00051863 predicted 1022
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024780 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00041115 predicted 678
2 SASI_Rn01_00041116 predicted 722
3 SASI_Rn01_00041117 predicted 224
4 SASI_Rn01_00041118 predicted 258
5 SASI_Rn01_00041119 predicted 366
6 SASI_Rn01_00041120 predicted 312
7 SASI_Rn01_00041122 predicted 872
8 SASI_Rn01_00041123 predicted 256
9 SASI_Rn01_00041124 predicted 493
10 SASI_Rn02_00202673 predicted 1053
11 SASI_Rn01_00041121 predicted 697
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011871 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00060555 predicted 891
2 SASI_Mm01_00060556 predicted 273
3 SASI_Mm01_00060557 predicted 1064
4 SASI_Mm02_00321655 predicted 887
5 SASI_Mm01_00060559 predicted 504
6 SASI_Mm01_00060560 predicted 235
7 SASI_Mm01_00060562 predicted 846
8 SASI_Mm02_00321656 predicted 495
9 SASI_Mm02_00321657 predicted 849
10 SASI_Mm02_00321658 predicted 698
11 SASI_Mm01_00060554 predicted 1033
12 SASI_Mm01_00060558 predicted 684
13 SASI_Mm01_00060561 predicted 1053
14 SASI_Mm01_00060563 predicted 273
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003690
VALIDATED
PRKRA MISSION shRNA Bacterial Glycerol Stock
protein kinase, interferon-inducible double stranded RNA dependent activator
Human
18 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000199545    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003690.3-976s1c1
Sequence:CCGGCCTGTGGCAATGCACAAAGTGCTCGAGCACTTTGTGCATTGCCACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196605    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_003690.3-1128s1c1
Sequence:CCGGGTAGTGTTTATGTCTTGTTTCCTCGAGGAAACAAGACATAAACACTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003690.3-285s1c1
Sequence:CCGGCAAATACACGTGCCCACTTTCCTCGAGGAAAGTGGGCACGTGTATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194656    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003690.3-1192s1c1
Sequence:CCGGCTCCTCATAGTTGTTATTAAGCTCGAGCTTAATAACAACTATGAGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194714    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003690.3-1430s1c1
Sequence:CCGGCCCTTTAGAATTAGAGTCTTGCTCGAGCAAGACTCTAATTCTAAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003690.3-352s1c1
Sequence:CCGGCAAGTAAGAAGCTGGCGAAACCTCGAGGTTTCGCCAGCTTCTTACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195535    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003690.3-1456s1c1
Sequence:CCGGCAGCACTAACAGGCCTTTATTCTCGAGAATAAAGGCCTGTTAGTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195728    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003690.3-718s1c1
Sequence:CCGGCAAATGTAGTAGGACATTCTTCTCGAGAAGAATGTCCTACTACATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_003690.3-660s1c1
Sequence:CCGGGCTGAGAAATTTCTTGCCAAACTCGAGTTTGGCAAGAAATTTCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196873    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_003690.3-1325s1c1
Sequence:CCGGGCATGTTTGTTGTTGATGATGCTCGAGCATCATCAACAACAAACATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_003690.3-599s1c1
Sequence:CCGGGCTAGAGTCATTTATGGAAACCTCGAGGTTTCCATAAATGACTCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196934    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003690.3-313s1c1
Sequence:CCGGGAGTAACCGTTGGTGACATAACTCGAGTTATGTCACCAACGGTTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003690.3-464s1c2
Sequence:CCGGGCAACCAAAGAACCAGCTTAACTCGAGTTAAGCTGGTTCTTTGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052643    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003690.3-464s1c1
Sequence:CCGGGCAACCAAAGAACCAGCTTAACTCGAGTTAAGCTGGTTCTTTGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_003690.3-802s1c1
Sequence:CCGGGCCTCCTTAGTATTCCAAATACTCGAGTATTTGGAATACTAAGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_003690.3-564s1c1
Sequence:CCGGCCTGCTCATAAGAGAGAATATCTCGAGATATTCTCTCTTATGAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_003690.3-211s1c1
Sequence:CCGGCGATTCAGGTATTACACGAATCTCGAGATTCGTGTAATACCTGAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052644    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_003690.3-901s1c1
Sequence:CCGGGCGCCAATGGACAATATCAATCTCGAGATTGATATTGTCCATTGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003690
VALIDATED
PRKRA MISSION shRNA shRNA Plasmid DNA
protein kinase, interferon-inducible double stranded RNA dependent activator
Human
18 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000199545    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003690.3-976s1c1
Sequence:CCGGCCTGTGGCAATGCACAAAGTGCTCGAGCACTTTGTGCATTGCCACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196605    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_003690.3-1128s1c1
Sequence:CCGGGTAGTGTTTATGTCTTGTTTCCTCGAGGAAACAAGACATAAACACTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003690.3-285s1c1
Sequence:CCGGCAAATACACGTGCCCACTTTCCTCGAGGAAAGTGGGCACGTGTATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194656    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003690.3-1192s1c1
Sequence:CCGGCTCCTCATAGTTGTTATTAAGCTCGAGCTTAATAACAACTATGAGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194714    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003690.3-1430s1c1
Sequence:CCGGCCCTTTAGAATTAGAGTCTTGCTCGAGCAAGACTCTAATTCTAAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003690.3-352s1c1
Sequence:CCGGCAAGTAAGAAGCTGGCGAAACCTCGAGGTTTCGCCAGCTTCTTACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195535    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003690.3-1456s1c1
Sequence:CCGGCAGCACTAACAGGCCTTTATTCTCGAGAATAAAGGCCTGTTAGTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195728    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003690.3-718s1c1
Sequence:CCGGCAAATGTAGTAGGACATTCTTCTCGAGAAGAATGTCCTACTACATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_003690.3-660s1c1
Sequence:CCGGGCTGAGAAATTTCTTGCCAAACTCGAGTTTGGCAAGAAATTTCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196873    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_003690.3-1325s1c1
Sequence:CCGGGCATGTTTGTTGTTGATGATGCTCGAGCATCATCAACAACAAACATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_003690.3-599s1c1
Sequence:CCGGGCTAGAGTCATTTATGGAAACCTCGAGGTTTCCATAAATGACTCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196934    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003690.3-313s1c1
Sequence:CCGGGAGTAACCGTTGGTGACATAACTCGAGTTATGTCACCAACGGTTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003690.3-464s1c2
Sequence:CCGGGCAACCAAAGAACCAGCTTAACTCGAGTTAAGCTGGTTCTTTGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052643    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003690.3-464s1c1
Sequence:CCGGGCAACCAAAGAACCAGCTTAACTCGAGTTAAGCTGGTTCTTTGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_003690.3-802s1c1
Sequence:CCGGGCCTCCTTAGTATTCCAAATACTCGAGTATTTGGAATACTAAGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_003690.3-564s1c1
Sequence:CCGGCCTGCTCATAAGAGAGAATATCTCGAGATATTCTCTCTTATGAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_003690.3-211s1c1
Sequence:CCGGCGATTCAGGTATTACACGAATCTCGAGATTCGTGTAATACCTGAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052644    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_003690.3-901s1c1
Sequence:CCGGGCGCCAATGGACAATATCAATCTCGAGATTGATATTGTCCATTGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003690
VALIDATED
PRKRA MISSION shRNA Lentiviral Transduction Particles
protein kinase, interferon-inducible double stranded RNA dependent activator
Human
18 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000199545    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003690.3-976s1c1
Sequence:CCGGCCTGTGGCAATGCACAAAGTGCTCGAGCACTTTGTGCATTGCCACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196605    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_003690.3-1128s1c1
Sequence:CCGGGTAGTGTTTATGTCTTGTTTCCTCGAGGAAACAAGACATAAACACTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003690.3-285s1c1
Sequence:CCGGCAAATACACGTGCCCACTTTCCTCGAGGAAAGTGGGCACGTGTATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194656    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003690.3-1192s1c1
Sequence:CCGGCTCCTCATAGTTGTTATTAAGCTCGAGCTTAATAACAACTATGAGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194714    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003690.3-1430s1c1
Sequence:CCGGCCCTTTAGAATTAGAGTCTTGCTCGAGCAAGACTCTAATTCTAAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003690.3-352s1c1
Sequence:CCGGCAAGTAAGAAGCTGGCGAAACCTCGAGGTTTCGCCAGCTTCTTACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195535    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003690.3-1456s1c1
Sequence:CCGGCAGCACTAACAGGCCTTTATTCTCGAGAATAAAGGCCTGTTAGTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195728    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003690.3-718s1c1
Sequence:CCGGCAAATGTAGTAGGACATTCTTCTCGAGAAGAATGTCCTACTACATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_003690.3-660s1c1
Sequence:CCGGGCTGAGAAATTTCTTGCCAAACTCGAGTTTGGCAAGAAATTTCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196873    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_003690.3-1325s1c1
Sequence:CCGGGCATGTTTGTTGTTGATGATGCTCGAGCATCATCAACAACAAACATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_003690.3-599s1c1
Sequence:CCGGGCTAGAGTCATTTATGGAAACCTCGAGGTTTCCATAAATGACTCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196934    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003690.3-313s1c1
Sequence:CCGGGAGTAACCGTTGGTGACATAACTCGAGTTATGTCACCAACGGTTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003690.3-464s1c2
Sequence:CCGGGCAACCAAAGAACCAGCTTAACTCGAGTTAAGCTGGTTCTTTGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052643    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003690.3-464s1c1
Sequence:CCGGGCAACCAAAGAACCAGCTTAACTCGAGTTAAGCTGGTTCTTTGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_003690.3-802s1c1
Sequence:CCGGGCCTCCTTAGTATTCCAAATACTCGAGTATTTGGAATACTAAGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_003690.3-564s1c1
Sequence:CCGGCCTGCTCATAAGAGAGAATATCTCGAGATATTCTCTCTTATGAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_003690.3-211s1c1
Sequence:CCGGCGATTCAGGTATTACACGAATCTCGAGATTCGTGTAATACCTGAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052644    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_003690.3-901s1c1
Sequence:CCGGGCGCCAATGGACAATATCAATCTCGAGATTGATATTGTCCATTGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011871
VALIDATED
PRKRA MISSION shRNA Bacterial Glycerol Stock
protein kinase, interferon-inducible double stranded RNA dependent activator
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000024834    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011871.1-891s1c1
Sequence:CCGGGCAAGGCTTTAACATAACGTACTCGAGTACGTTATGTTAAAGCCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011871.1-445s1c1
Sequence:CCGGGCAAGTATTTGCTTTGCAGTTCTCGAGAACTGCAAAGCAAATACTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011871.1-727s1c1
Sequence:CCGGCCAGAGAACCACATTTCTCTACTCGAGTAGAGAAATGTGGTTCTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011871.1-554s1c1
Sequence:CCGGGCTGGCGACTTCCTGAATATACTCGAGTATATTCAGGAAGTCGCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011871.1-264s1c1
Sequence:CCGGCGGCATGAAGACCAAGAACATCTCGAGATGTTCTTGGTCTTCATGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011871
VALIDATED
PRKRA MISSION shRNA shRNA Plasmid DNA
protein kinase, interferon-inducible double stranded RNA dependent activator
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000024834    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011871.1-891s1c1
Sequence:CCGGGCAAGGCTTTAACATAACGTACTCGAGTACGTTATGTTAAAGCCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011871.1-445s1c1
Sequence:CCGGGCAAGTATTTGCTTTGCAGTTCTCGAGAACTGCAAAGCAAATACTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011871.1-727s1c1
Sequence:CCGGCCAGAGAACCACATTTCTCTACTCGAGTAGAGAAATGTGGTTCTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011871.1-554s1c1
Sequence:CCGGGCTGGCGACTTCCTGAATATACTCGAGTATATTCAGGAAGTCGCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011871.1-264s1c1
Sequence:CCGGCGGCATGAAGACCAAGAACATCTCGAGATGTTCTTGGTCTTCATGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011871
VALIDATED
PRKRA MISSION shRNA Lentiviral Transduction Particles
protein kinase, interferon-inducible double stranded RNA dependent activator
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000024834    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011871.1-891s1c1
Sequence:CCGGGCAAGGCTTTAACATAACGTACTCGAGTACGTTATGTTAAAGCCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011871.1-445s1c1
Sequence:CCGGGCAAGTATTTGCTTTGCAGTTCTCGAGAACTGCAAAGCAAATACTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011871.1-727s1c1
Sequence:CCGGCCAGAGAACCACATTTCTCTACTCGAGTAGAGAAATGTGGTTCTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011871.1-554s1c1
Sequence:CCGGGCTGGCGACTTCCTGAATATACTCGAGTATATTCAGGAAGTCGCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011871.1-264s1c1
Sequence:CCGGCGGCATGAAGACCAAGAACATCTCGAGATGTTCTTGGTCTTCATGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks