EMAIL THIS PAGE TO A FRIEND

PRKX

protein kinase, X-linked

Synonyms: PKX1
UniProtKB ID: P51817
Gene ID:
Human(5613) Summary: This gene encodes a serine threonine protein kinase that has similarity to the catalytic subunit of cyclic AMP dependent protein kinases. The encoded protein is developmentally regulated and may be involved in renal epithelial morphogenesis. This protein may also be involved in macrophage and granulocyte maturation. Abnormal recombination between this gene and a related pseudogene on chromosome Y is a frequent cause of sex reversal disorder in XX males and XY females. Pseudogenes of this gene are found on chromosomes X, 15 and Y. [provided by RefSeq, Feb 2010]
Mouse(19108) protein kinase, X-linked
Rat(501563) protein kinase, X-linked
chicken(418656) protein kinase, X-linked
dog(610031) protein kinase, X-linked
domestic cat(101081957) protein kinase, X-linked
naked mole-rat(101700033) protein kinase, X-linked
cow(505773) protein kinase, X-linked
sheep(101116807) protein kinase, X-linked
78 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005044 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005044 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005044 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_016979 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016979 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016979 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005044 Rosetta Predictions human pricing
NM_001033963 Rosetta Predictions rat pricing
NM_016979 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005044 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00226424 predicted 483
2 SASI_Hs01_00226425 predicted 1242
3 SASI_Hs01_00226426 predicted 1529
4 SASI_Hs01_00226427 predicted 1208
5 SASI_Hs01_00226428 predicted 1211
6 SASI_Hs01_00226429 predicted 1217
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033963 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00049806 predicted 930
2 SASI_Rn01_00049807 predicted 415
3 SASI_Rn01_00049808 predicted 709
4 SASI_Rn01_00049809 predicted 527
5 SASI_Rn01_00049810 predicted 1188
6 SASI_Rn01_00049811 predicted 470
7 SASI_Rn01_00049813 predicted 509
8 SASI_Rn01_00049814 predicted 695
9 SASI_Rn01_00049815 predicted 843
10 SASI_Rn02_00203841 predicted 690
11 SASI_Rn01_00049812 predicted 1003
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016979 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00027303 predicted 472
2 SASI_Mm01_00027304 predicted 670
3 SASI_Mm01_00027305 predicted 461
4 SASI_Mm01_00027306 predicted 1337
5 SASI_Mm01_00027307 predicted 1203
6 SASI_Mm01_00027308 predicted 537
7 SASI_Mm01_00027309 predicted 1251
8 SASI_Mm01_00027310 predicted 1321
9 SASI_Mm01_00027311 predicted 837
10 SASI_Mm01_00027312 predicted 593
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005044
PRKX MISSION shRNA Bacterial Glycerol Stock
protein kinase, X-linked
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000010652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005044.x-1332s1c1
Sequence:CCGGCAAGATAGCTGGTGACGGCGACTCGAGTCGCCGTCACCAGCTATCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001784    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005044.x-1710s1c1
Sequence:CCGGCCTACTGTGATGTCTTGGTTTCTCGAGAAACCAAGACATCACAGTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005044.x-1221s1c1
Sequence:CCGGGCGATTAGGAAACATGAAGAACTCGAGTTCTTCATGTTTCCTAATCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005044.x-628s1c1
Sequence:CCGGCTAAAGCAGGAGCAACACGTACTCGAGTACGTGTTGCTCCTGCTTTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005044.x-1217s1c1
Sequence:CCGGCAAGGCGATTAGGAAACATGACTCGAGTCATGTTTCCTAATCGCCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199803    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005044.1-1058s1c1
Sequence:CCGGGCATCCTGATATTCGAGATGCCTCGAGGCATCTCGAATATCAGGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199522    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005044.1-813s1c1
Sequence:CCGGGCTCTTCTACTCTGCAGAGATCTCGAGATCTCTGCAGAGTAGAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199596    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005044.1-907s1c1
Sequence:CCGGGATAGGGATGGCCACATTAAGCTCGAGCTTAATGTGGCCATCCCTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199547    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005044.1-579s1c1
Sequence:CCGGCAAGCATTTCTTCGCCCTCAACTCGAGTTGAGGGCGAAGAAATGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005044
PRKX MISSION shRNA shRNA Plasmid DNA
protein kinase, X-linked
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000010652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005044.x-1332s1c1
Sequence:CCGGCAAGATAGCTGGTGACGGCGACTCGAGTCGCCGTCACCAGCTATCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001784    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005044.x-1710s1c1
Sequence:CCGGCCTACTGTGATGTCTTGGTTTCTCGAGAAACCAAGACATCACAGTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005044.x-1221s1c1
Sequence:CCGGGCGATTAGGAAACATGAAGAACTCGAGTTCTTCATGTTTCCTAATCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005044.x-628s1c1
Sequence:CCGGCTAAAGCAGGAGCAACACGTACTCGAGTACGTGTTGCTCCTGCTTTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005044.x-1217s1c1
Sequence:CCGGCAAGGCGATTAGGAAACATGACTCGAGTCATGTTTCCTAATCGCCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199803    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005044.1-1058s1c1
Sequence:CCGGGCATCCTGATATTCGAGATGCCTCGAGGCATCTCGAATATCAGGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199522    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005044.1-813s1c1
Sequence:CCGGGCTCTTCTACTCTGCAGAGATCTCGAGATCTCTGCAGAGTAGAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199596    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005044.1-907s1c1
Sequence:CCGGGATAGGGATGGCCACATTAAGCTCGAGCTTAATGTGGCCATCCCTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199547    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005044.1-579s1c1
Sequence:CCGGCAAGCATTTCTTCGCCCTCAACTCGAGTTGAGGGCGAAGAAATGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005044
PRKX MISSION shRNA Lentiviral Transduction Particles
protein kinase, X-linked
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000010652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005044.x-1332s1c1
Sequence:CCGGCAAGATAGCTGGTGACGGCGACTCGAGTCGCCGTCACCAGCTATCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001784    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005044.x-1710s1c1
Sequence:CCGGCCTACTGTGATGTCTTGGTTTCTCGAGAAACCAAGACATCACAGTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005044.x-1221s1c1
Sequence:CCGGGCGATTAGGAAACATGAAGAACTCGAGTTCTTCATGTTTCCTAATCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005044.x-628s1c1
Sequence:CCGGCTAAAGCAGGAGCAACACGTACTCGAGTACGTGTTGCTCCTGCTTTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005044.x-1217s1c1
Sequence:CCGGCAAGGCGATTAGGAAACATGACTCGAGTCATGTTTCCTAATCGCCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199803    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005044.1-1058s1c1
Sequence:CCGGGCATCCTGATATTCGAGATGCCTCGAGGCATCTCGAATATCAGGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199522    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005044.1-813s1c1
Sequence:CCGGGCTCTTCTACTCTGCAGAGATCTCGAGATCTCTGCAGAGTAGAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199596    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005044.1-907s1c1
Sequence:CCGGGATAGGGATGGCCACATTAAGCTCGAGCTTAATGTGGCCATCCCTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199547    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005044.1-579s1c1
Sequence:CCGGCAAGCATTTCTTCGCCCTCAACTCGAGTTGAGGGCGAAGAAATGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016979
PRKX MISSION shRNA Bacterial Glycerol Stock
protein kinase, X-linked
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000022788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016979.1-1103s1c1
Sequence:CCGGCGCCTAGGCAACATGAAGAATCTCGAGATTCTTCATGTTGCCTAGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016979.1-382s1c1
Sequence:CCGGGTTACAAGATTGGGACACCATCTCGAGATGGTGTCCCAATCTTGTAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016979.1-1226s1c1
Sequence:CCGGGATGGTGACATCTCCAACTTTCTCGAGAAAGTTGGAGATGTCACCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016979.1-992s1c1
Sequence:CCGGCCGTTTGGGATTTACCAGAAACTCGAGTTTCTGGTAAATCCCAAACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016979
PRKX MISSION shRNA shRNA Plasmid DNA
protein kinase, X-linked
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000022788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016979.1-1103s1c1
Sequence:CCGGCGCCTAGGCAACATGAAGAATCTCGAGATTCTTCATGTTGCCTAGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016979.1-382s1c1
Sequence:CCGGGTTACAAGATTGGGACACCATCTCGAGATGGTGTCCCAATCTTGTAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016979.1-1226s1c1
Sequence:CCGGGATGGTGACATCTCCAACTTTCTCGAGAAAGTTGGAGATGTCACCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016979.1-992s1c1
Sequence:CCGGCCGTTTGGGATTTACCAGAAACTCGAGTTTCTGGTAAATCCCAAACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016979
PRKX MISSION shRNA Lentiviral Transduction Particles
protein kinase, X-linked
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000022788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016979.1-1103s1c1
Sequence:CCGGCGCCTAGGCAACATGAAGAATCTCGAGATTCTTCATGTTGCCTAGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016979.1-382s1c1
Sequence:CCGGGTTACAAGATTGGGACACCATCTCGAGATGGTGTCCCAATCTTGTAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016979.1-1226s1c1
Sequence:CCGGGATGGTGACATCTCCAACTTTCTCGAGAAAGTTGGAGATGTCACCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016979.1-992s1c1
Sequence:CCGGCCGTTTGGGATTTACCAGAAACTCGAGTTTCTGGTAAATCCCAAACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks