EMAIL THIS PAGE TO A FRIEND

PRMT3

protein arginine methyltransferase 3

Synonyms: HRMT1L3
UniProtKB ID: O60678, B4DUC7
Gene ID:
Human(10196) Summary: Type I protein arginine N-methyltransferases (PRMTs), such as PRMT3, catalyze the formation of asymmetric N(G),N(G)-dimethylarginine (ADMA) residues in proteins (Tang et al., 1998 [PubMed 9642256]
Mouse(71974) protein arginine N-methyltransferase 3
Rat(89820) protein arginine methyltransferase 3
Domestic Rabbit(100340303) protein arginine methyltransferase 3
naked mole-rat(101725286) protein arginine methyltransferase 3
domestic guinea pig(100722399) protein arginine methyltransferase 3
cow(523174) protein arginine methyltransferase 3
sheep(101113707) protein arginine methyltransferase 3
Thale Cress(820407) protein arginine N-methyltransferase 3
Zebrafish(550348) protein arginine methyltransferase 3
Horse(100072014) protein arginine methyltransferase 3
domestic cat(101084735) protein arginine methyltransferase 3
dog(476887) protein arginine methyltransferase 3
chicken(422975) protein arginine methyltransferase 3
90 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005788 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005788 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005788 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_133740 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133740 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133740 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU083191 MISSION® esiRNA esiRNA human PRMT3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005788 Rosetta Predictions human pricing
NM_053557 Rosetta Predictions rat pricing
NM_133740 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005788 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00217282 predicted 1052
2 SASI_Hs01_00217283 predicted 935
3 SASI_Hs01_00217284 predicted 993
4 SASI_Hs02_00340283 predicted 1030
5 SASI_Hs02_00340284 predicted 1745
6 SASI_Hs01_00217285 predicted 1866
7 SASI_Hs01_00217286 predicted 1349
8 SASI_Hs01_00217287 predicted 1575
9 SASI_Hs01_00217288 predicted 388
10 SASI_Hs01_00217289 predicted 1534
11 SASI_Hs01_00217290 predicted 1445
12 SASI_Hs01_00217291 predicted 457
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053557 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00034595 predicted 1317
2 SASI_Rn01_00034596 predicted 750
3 SASI_Rn01_00034597 predicted 1713
4 SASI_Rn01_00034598 predicted 268
5 SASI_Rn01_00034599 predicted 904
6 SASI_Rn01_00034600 predicted 1185
7 SASI_Rn01_00034601 predicted 795
8 SASI_Rn01_00034602 predicted 1299
9 SASI_Rn01_00034603 predicted 1499
10 SASI_Rn02_00266214 predicted 335
11 SASI_Rn01_00034594 predicted 1272
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133740 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00057440 predicted 700
2 SASI_Mm02_00338725 predicted 1074
3 SASI_Mm01_00057441 predicted 1369
4 SASI_Mm01_00057442 predicted 785
5 SASI_Mm01_00057443 predicted 304
6 SASI_Mm01_00057445 predicted 1491
7 SASI_Mm01_00057446 predicted 1132
8 SASI_Mm01_00057447 predicted 373
9 SASI_Mm01_00057448 predicted 829
10 SASI_Mm01_00057449 predicted 943
11 SASI_Mm01_00057444 predicted 1273
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005788
VALIDATED
PRMT3 MISSION shRNA Bacterial Glycerol Stock
protein arginine methyltransferase 3
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000380837    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005788.3-2007s21c1
Sequence:GTACCGGTGGTCTGCCACGTAATCATTTCTCGAGAAATGATTACGTGGCAGACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299321    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005788.3-1463s21c1
Sequence:CCGGCCTTGTGGTATTAAGCATATACTCGAGTATATGCTTAATACCACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299324    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005788.3-557s21c1
Sequence:CCGGCCTTGGGAGAAAGAAGAGTATCTCGAGATACTCTTCTTTCTCCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299323    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005788.3-1765s21c1
Sequence:CCGGCGTGACCCTCACGTTGAATAACTCGAGTTATTCAACGTGAGGGTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005788.3-1322s21c1
Sequence:CCGGGCAGTGAGTGATGTGAATAAACTCGAGTTTATTCACATCACTCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379742    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005788.3-2033s21c1
Sequence:GTACCGGGACGTTTGCTCCACCAGATTTCTCGAGAAATCTGGTGGAGCAAACGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034569    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005788.1-532s1c1
Sequence:CCGGCCTTGGGAGAAAGAAGAGTATCTCGAGATACTCTTCTTTCTCCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005788.1-1740s1c1
Sequence:CCGGCGTGACCCTCACGTTGAATAACTCGAGTTATTCAACGTGAGGGTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005788.1-1297s1c1
Sequence:CCGGGCAGTGAGTGATGTGAATAAACTCGAGTTTATTCACATCACTCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005788.1-1438s1c1
Sequence:CCGGCCTTGTGGTATTAAGCATATACTCGAGTATATGCTTAATACCACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005788.1-1546s1c1
Sequence:CCGGGCTGGCTACTTTGATATATATCTCGAGATATATATCAAAGTAGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005788
VALIDATED
PRMT3 MISSION shRNA shRNA Plasmid DNA
protein arginine methyltransferase 3
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000380837    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005788.3-2007s21c1
Sequence:GTACCGGTGGTCTGCCACGTAATCATTTCTCGAGAAATGATTACGTGGCAGACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299321    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005788.3-1463s21c1
Sequence:CCGGCCTTGTGGTATTAAGCATATACTCGAGTATATGCTTAATACCACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299324    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005788.3-557s21c1
Sequence:CCGGCCTTGGGAGAAAGAAGAGTATCTCGAGATACTCTTCTTTCTCCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299323    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005788.3-1765s21c1
Sequence:CCGGCGTGACCCTCACGTTGAATAACTCGAGTTATTCAACGTGAGGGTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005788.3-1322s21c1
Sequence:CCGGGCAGTGAGTGATGTGAATAAACTCGAGTTTATTCACATCACTCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379742    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005788.3-2033s21c1
Sequence:GTACCGGGACGTTTGCTCCACCAGATTTCTCGAGAAATCTGGTGGAGCAAACGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034569    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005788.1-532s1c1
Sequence:CCGGCCTTGGGAGAAAGAAGAGTATCTCGAGATACTCTTCTTTCTCCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005788.1-1740s1c1
Sequence:CCGGCGTGACCCTCACGTTGAATAACTCGAGTTATTCAACGTGAGGGTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005788.1-1297s1c1
Sequence:CCGGGCAGTGAGTGATGTGAATAAACTCGAGTTTATTCACATCACTCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005788.1-1438s1c1
Sequence:CCGGCCTTGTGGTATTAAGCATATACTCGAGTATATGCTTAATACCACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005788.1-1546s1c1
Sequence:CCGGGCTGGCTACTTTGATATATATCTCGAGATATATATCAAAGTAGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005788
VALIDATED
PRMT3 MISSION shRNA Lentiviral Transduction Particles
protein arginine methyltransferase 3
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000380837    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005788.3-2007s21c1
Sequence:GTACCGGTGGTCTGCCACGTAATCATTTCTCGAGAAATGATTACGTGGCAGACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299321    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005788.3-1463s21c1
Sequence:CCGGCCTTGTGGTATTAAGCATATACTCGAGTATATGCTTAATACCACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299324    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005788.3-557s21c1
Sequence:CCGGCCTTGGGAGAAAGAAGAGTATCTCGAGATACTCTTCTTTCTCCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299323    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005788.3-1765s21c1
Sequence:CCGGCGTGACCCTCACGTTGAATAACTCGAGTTATTCAACGTGAGGGTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005788.3-1322s21c1
Sequence:CCGGGCAGTGAGTGATGTGAATAAACTCGAGTTTATTCACATCACTCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379742    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005788.3-2033s21c1
Sequence:GTACCGGGACGTTTGCTCCACCAGATTTCTCGAGAAATCTGGTGGAGCAAACGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034569    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005788.1-532s1c1
Sequence:CCGGCCTTGGGAGAAAGAAGAGTATCTCGAGATACTCTTCTTTCTCCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005788.1-1740s1c1
Sequence:CCGGCGTGACCCTCACGTTGAATAACTCGAGTTATTCAACGTGAGGGTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005788.1-1297s1c1
Sequence:CCGGGCAGTGAGTGATGTGAATAAACTCGAGTTTATTCACATCACTCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005788.1-1438s1c1
Sequence:CCGGCCTTGTGGTATTAAGCATATACTCGAGTATATGCTTAATACCACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005788.1-1546s1c1
Sequence:CCGGGCTGGCTACTTTGATATATATCTCGAGATATATATCAAAGTAGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133740
VALIDATED
PRMT3 MISSION shRNA Bacterial Glycerol Stock
protein arginine methyltransferase 3
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000332168    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133740.2-1967s21c1
Sequence:CCGGCCTGCTAGACTGAGAGTCATTCTCGAGAATGACTCTCAGTCTAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133740.2-1652s21c1
Sequence:CCGGCCTCATTGTGACCCTGACTTTCTCGAGAAAGTCAGGGTCACAATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332236    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133740.2-414s21c1
Sequence:CCGGCCTACGGTTGAATATATGAATCTCGAGATTCATATATTCAACCGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133740.2-826s21c1
Sequence:CCGGGCACAGAAAGTTACAGAGATTCTCGAGAATCTCTGTAACTTTCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097489    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133740.1-1968s1c1
Sequence:CCGGCCTGCTAGACTGAGAGTCATTCTCGAGAATGACTCTCAGTCTAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097493    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133740.1-1653s1c1
Sequence:CCGGCCTCATTGTGACCCTGACTTTCTCGAGAAAGTCAGGGTCACAATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133740.1-827s1c1
Sequence:CCGGGCACAGAAAGTTACAGAGATTCTCGAGAATCTCTGTAACTTTCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097491    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133740.1-826s1c1
Sequence:CCGGCGCACAGAAAGTTACAGAGATCTCGAGATCTCTGTAACTTTCTGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097492    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133740.1-415s1c1
Sequence:CCGGCCTACGGTTGAATATATGAATCTCGAGATTCATATATTCAACCGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133740
VALIDATED
PRMT3 MISSION shRNA shRNA Plasmid DNA
protein arginine methyltransferase 3
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000332168    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133740.2-1967s21c1
Sequence:CCGGCCTGCTAGACTGAGAGTCATTCTCGAGAATGACTCTCAGTCTAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133740.2-1652s21c1
Sequence:CCGGCCTCATTGTGACCCTGACTTTCTCGAGAAAGTCAGGGTCACAATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332236    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133740.2-414s21c1
Sequence:CCGGCCTACGGTTGAATATATGAATCTCGAGATTCATATATTCAACCGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133740.2-826s21c1
Sequence:CCGGGCACAGAAAGTTACAGAGATTCTCGAGAATCTCTGTAACTTTCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097489    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133740.1-1968s1c1
Sequence:CCGGCCTGCTAGACTGAGAGTCATTCTCGAGAATGACTCTCAGTCTAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097493    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133740.1-1653s1c1
Sequence:CCGGCCTCATTGTGACCCTGACTTTCTCGAGAAAGTCAGGGTCACAATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133740.1-827s1c1
Sequence:CCGGGCACAGAAAGTTACAGAGATTCTCGAGAATCTCTGTAACTTTCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097491    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133740.1-826s1c1
Sequence:CCGGCGCACAGAAAGTTACAGAGATCTCGAGATCTCTGTAACTTTCTGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097492    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133740.1-415s1c1
Sequence:CCGGCCTACGGTTGAATATATGAATCTCGAGATTCATATATTCAACCGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133740
VALIDATED
PRMT3 MISSION shRNA Lentiviral Transduction Particles
protein arginine methyltransferase 3
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000332168    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133740.2-1967s21c1
Sequence:CCGGCCTGCTAGACTGAGAGTCATTCTCGAGAATGACTCTCAGTCTAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133740.2-1652s21c1
Sequence:CCGGCCTCATTGTGACCCTGACTTTCTCGAGAAAGTCAGGGTCACAATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332236    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133740.2-414s21c1
Sequence:CCGGCCTACGGTTGAATATATGAATCTCGAGATTCATATATTCAACCGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133740.2-826s21c1
Sequence:CCGGGCACAGAAAGTTACAGAGATTCTCGAGAATCTCTGTAACTTTCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097489    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133740.1-1968s1c1
Sequence:CCGGCCTGCTAGACTGAGAGTCATTCTCGAGAATGACTCTCAGTCTAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097493    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133740.1-1653s1c1
Sequence:CCGGCCTCATTGTGACCCTGACTTTCTCGAGAAAGTCAGGGTCACAATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133740.1-827s1c1
Sequence:CCGGGCACAGAAAGTTACAGAGATTCTCGAGAATCTCTGTAACTTTCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097491    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133740.1-826s1c1
Sequence:CCGGCGCACAGAAAGTTACAGAGATCTCGAGATCTCTGTAACTTTCTGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097492    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133740.1-415s1c1
Sequence:CCGGCCTACGGTTGAATATATGAATCTCGAGATTCATATATTCAACCGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks