EMAIL THIS PAGE TO A FRIEND

PRMT6

protein arginine methyltransferase 6

Synonyms: HRMT1L6
UniProtKB ID: Q96LA8, A3KME1, B4DID8, Q5T5Y5, Q6DKI4, Q9NVR8
Gene ID:
Human(55170) Summary: The protein encoded by this gene belongs to the arginine N-methyltransferase family, which catalyze the sequential transfer of methyl group from S-adenosyl-L-methionine to the side chain nitrogens of arginine residues within proteins, to form methylated arginine derivatives and S-adenosyl-L-homocysteine. This protein can catalyze both, the formation of omega-N monomethylarginine and asymmetrical dimethylarginine, with a strong preference for the latter. It specifically mediates the asymmetric dimethylation of Arg2 of histone H3, and the methylated form represents a specific tag for epigenetic transcriptional repression. This protein also forms a complex with, and methylates DNA polymerase beta, resulting in stimulation of polymerase activity by enhancing DNA binding and processivity. [provided by RefSeq, Sep 2011]
Mouse(99890) protein arginine N-methyltransferase 6
Rat(295384) protein arginine methyltransferase 6
Thale Cress(821541) protein arginine N-methyltransferase 6
domestic cat(101093626) protein arginine methyltransferase 6
dog(490133) protein arginine methyltransferase 6
Zebrafish(448867) protein arginine methyltransferase 6
naked mole-rat(101715374) protein arginine methyltransferase 6
domestic guinea pig(100725259) protein arginine methyltransferase 6
cow(540228) protein arginine methyltransferase 6
sheep(101119859) protein arginine methyltransferase 6
69 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1300138 Anti-PRMT6 (N-term) antibody produced in rabbit saturated ammonium sulfate (SAS) precipitated, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
P6495 Anti-PRMT6 (SE-15) antibody produced in rabbit ~0.9 mg/mL, affinity isolated antibody, buffered aqueous solution human
immunofluorescence, immunoprecipitation, microarray, western blot pricing
SAB2502076 Anti-PRMT6 antibody produced in goat affinity isolated antibody, buffered aqueous solution mouse, rat, human, pig
ELISA, western blot pricing
SAB1409484 Anti-PRMT6 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
SAB2101883 Anti-PRMT6 antibody produced in rabbit affinity isolated antibody human, bovine, mouse, canine, rat, guinea pig, horse
western blot pricing
HPA059424 Anti-PRMT6 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB2106502 Anti-PRMT6 antibody produced in rabbit affinity isolated antibody guinea pig, horse, rat, human
ELISA, western blot pricing
SAB1411037 Anti-PRMT6 antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
P2996 Monoclonal Anti-PRMT6 antibody produced in mouse clone PRMT6-74, purified immunoglobulin, buffered aqueous solution human
ELISA, immunocytochemistry, immunoprecipitation, microarray, western blot pricing
SAB5300219 Monoclonal Anti-PRMT6 antibody produced in mouse clone 4G2, ascites fluid human, monkey
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018137 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018137 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018137 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_178891 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178891 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178891 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018137 Rosetta Predictions human pricing
NM_001106466 Rosetta Predictions rat pricing
NM_178891 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018137 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00204109 predicted 359
2 SASI_Hs01_00204110 predicted 931
3 SASI_Hs01_00204112 predicted 1263
4 SASI_Hs01_00204113 predicted 1459
5 SASI_Hs01_00204114 predicted 1315
6 SASI_Hs02_00351356 predicted 682
7 SASI_Hs02_00351357 predicted 842
8 SASI_Hs01_00204115 predicted 1223
9 SASI_Hs02_00351358 predicted 1547
10 SASI_Hs01_00204116 predicted 1276
11 SASI_Hs01_00204108 predicted 785
12 SASI_Hs01_00204111 predicted 1203
13 SASI_Hs01_00204117 predicted 260
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106466 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00219238 predicted 1235
2 SASI_Rn02_00219239 predicted 1823
3 SASI_Rn02_00219240 predicted 1788
4 SASI_Rn02_00219241 predicted 1842
5 SASI_Rn02_00219242 predicted 1819
6 SASI_Rn02_00219243 predicted 1663
7 SASI_Rn02_00219244 predicted 1839
8 SASI_Rn02_00219245 predicted 1612
9 SASI_Rn02_00219246 predicted 1616
10 SASI_Rn02_00219247 predicted 1694
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178891 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00349482 predicted 985
2 SASI_Mm02_00349483 predicted 944
3 SASI_Mm02_00349484 predicted 936
4 SASI_Mm01_00184532 predicted 683
5 SASI_Mm02_00349485 predicted 719
6 SASI_Mm02_00349486 predicted 736
7 SASI_Mm02_00349487 predicted 871
8 SASI_Mm02_00349488 predicted 491
9 SASI_Mm02_00349489 predicted 277
10 SASI_Mm02_00349490 predicted 1149
11 SASI_Mm01_00184525 predicted 1321
12 SASI_Mm01_00184526 predicted 1312
13 SASI_Mm01_00184527 predicted 1630
14 SASI_Mm01_00184528 predicted 1601
15 SASI_Mm01_00184529 predicted 1243
16 SASI_Mm01_00184530 predicted 1300
17 SASI_Mm01_00184531 predicted 1499
18 SASI_Mm01_00184533 predicted 1459
19 SASI_Mm01_00184534 predicted 1392
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018137
VALIDATED
PRMT6 MISSION shRNA Bacterial Glycerol Stock
protein arginine methyltransferase 6
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000299956    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_018137.2-347s21c1
Sequence:CCGGCACCGGCATTCTGAGCATCTTCTCGAGAAGATGCTCAGAATGCCGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_018137.2-485s21c1
Sequence:CCGGACCAGTGGAGACTGTAGAGTTCTCGAGAACTCTACAGTCTCCACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018137.2-590s21c1
Sequence:CCGGGCGAACCAAGTGGCTGAAGGACTCGAGTCCTTCAGCCACTTGGTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_018137.2-1073s21c1
Sequence:CCGGCACGGACGTTTCAGGAGAGATCTCGAGATCTCTCCTGAAACGTCCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018137.1-448s1c1
Sequence:CCGGGCGAACCAAGTGGCTGAAGGACTCGAGTCCTTCAGCCACTTGGTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018137.1-931s1c1
Sequence:CCGGCACGGACGTTTCAGGAGAGATCTCGAGATCTCTCCTGAAACGTCCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018137.1-205s1c1
Sequence:CCGGCACCGGCATTCTGAGCATCTTCTCGAGAAGATGCTCAGAATGCCGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018137
VALIDATED
PRMT6 MISSION shRNA shRNA Plasmid DNA
protein arginine methyltransferase 6
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000299956    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_018137.2-347s21c1
Sequence:CCGGCACCGGCATTCTGAGCATCTTCTCGAGAAGATGCTCAGAATGCCGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_018137.2-485s21c1
Sequence:CCGGACCAGTGGAGACTGTAGAGTTCTCGAGAACTCTACAGTCTCCACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018137.2-590s21c1
Sequence:CCGGGCGAACCAAGTGGCTGAAGGACTCGAGTCCTTCAGCCACTTGGTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_018137.2-1073s21c1
Sequence:CCGGCACGGACGTTTCAGGAGAGATCTCGAGATCTCTCCTGAAACGTCCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018137.1-448s1c1
Sequence:CCGGGCGAACCAAGTGGCTGAAGGACTCGAGTCCTTCAGCCACTTGGTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018137.1-931s1c1
Sequence:CCGGCACGGACGTTTCAGGAGAGATCTCGAGATCTCTCCTGAAACGTCCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018137.1-205s1c1
Sequence:CCGGCACCGGCATTCTGAGCATCTTCTCGAGAAGATGCTCAGAATGCCGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018137
VALIDATED
PRMT6 MISSION shRNA Lentiviral Transduction Particles
protein arginine methyltransferase 6
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000299956    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_018137.2-347s21c1
Sequence:CCGGCACCGGCATTCTGAGCATCTTCTCGAGAAGATGCTCAGAATGCCGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_018137.2-485s21c1
Sequence:CCGGACCAGTGGAGACTGTAGAGTTCTCGAGAACTCTACAGTCTCCACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018137.2-590s21c1
Sequence:CCGGGCGAACCAAGTGGCTGAAGGACTCGAGTCCTTCAGCCACTTGGTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_018137.2-1073s21c1
Sequence:CCGGCACGGACGTTTCAGGAGAGATCTCGAGATCTCTCCTGAAACGTCCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018137.1-448s1c1
Sequence:CCGGGCGAACCAAGTGGCTGAAGGACTCGAGTCCTTCAGCCACTTGGTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018137.1-931s1c1
Sequence:CCGGCACGGACGTTTCAGGAGAGATCTCGAGATCTCTCCTGAAACGTCCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018137.1-205s1c1
Sequence:CCGGCACCGGCATTCTGAGCATCTTCTCGAGAAGATGCTCAGAATGCCGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178891
VALIDATED
PRMT6 MISSION shRNA Bacterial Glycerol Stock
protein arginine methyltransferase 6
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000295331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178891.4-245s21c1
Sequence:CCGGACCGCTTAGGCATCCTGAAGACTCGAGTCTTCAGGATGCCTAAGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178891.4-168s21c1
Sequence:CCGGCCAGCTGTACTACGAGTGCTACTCGAGTAGCACTCGTAGTACAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287979    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178891.4-1096s21c1
Sequence:CCGGCGCATACTTCTGCGCTACAAACTCGAGTTTGTAGCGCAGAAGTATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295269    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178891.4-1368s21c1
Sequence:CCGGCTGGAAAGCATGTAGTATAAACTCGAGTTTATACTACATGCTTTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178891.4-892s21c1
Sequence:CCGGCATGGTTTCGCCGTCTGGTTTCTCGAGAAACCAGACGGCGAAACCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097494    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178891.3-1538s1c1
Sequence:CCGGCCCTCCTCATACCATTTATTTCTCGAGAAATAAATGGTATGAGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178891.3-1005s1c1
Sequence:CCGGGTGGAACAAGATACGGACATTCTCGAGAATGTCCGTATCTTGTTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178891.3-662s1c1
Sequence:CCGGCGTGGATATGAGCTGCATGGACTCGAGTCCATGCAGCTCATATCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178891.3-146s1c1
Sequence:CCGGCCAGCTGTACTACGAGTGCTACTCGAGTAGCACTCGTAGTACAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178891.3-1074s1c1
Sequence:CCGGCGCATACTTCTGCGCTACAAACTCGAGTTTGTAGCGCAGAAGTATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178891
VALIDATED
PRMT6 MISSION shRNA shRNA Plasmid DNA
protein arginine methyltransferase 6
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000295331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178891.4-245s21c1
Sequence:CCGGACCGCTTAGGCATCCTGAAGACTCGAGTCTTCAGGATGCCTAAGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178891.4-168s21c1
Sequence:CCGGCCAGCTGTACTACGAGTGCTACTCGAGTAGCACTCGTAGTACAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287979    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178891.4-1096s21c1
Sequence:CCGGCGCATACTTCTGCGCTACAAACTCGAGTTTGTAGCGCAGAAGTATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295269    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178891.4-1368s21c1
Sequence:CCGGCTGGAAAGCATGTAGTATAAACTCGAGTTTATACTACATGCTTTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178891.4-892s21c1
Sequence:CCGGCATGGTTTCGCCGTCTGGTTTCTCGAGAAACCAGACGGCGAAACCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097494    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178891.3-1538s1c1
Sequence:CCGGCCCTCCTCATACCATTTATTTCTCGAGAAATAAATGGTATGAGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178891.3-1005s1c1
Sequence:CCGGGTGGAACAAGATACGGACATTCTCGAGAATGTCCGTATCTTGTTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178891.3-662s1c1
Sequence:CCGGCGTGGATATGAGCTGCATGGACTCGAGTCCATGCAGCTCATATCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178891.3-146s1c1
Sequence:CCGGCCAGCTGTACTACGAGTGCTACTCGAGTAGCACTCGTAGTACAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178891.3-1074s1c1
Sequence:CCGGCGCATACTTCTGCGCTACAAACTCGAGTTTGTAGCGCAGAAGTATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178891
VALIDATED
PRMT6 MISSION shRNA Lentiviral Transduction Particles
protein arginine methyltransferase 6
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000295331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178891.4-245s21c1
Sequence:CCGGACCGCTTAGGCATCCTGAAGACTCGAGTCTTCAGGATGCCTAAGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178891.4-168s21c1
Sequence:CCGGCCAGCTGTACTACGAGTGCTACTCGAGTAGCACTCGTAGTACAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287979    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178891.4-1096s21c1
Sequence:CCGGCGCATACTTCTGCGCTACAAACTCGAGTTTGTAGCGCAGAAGTATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295269    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178891.4-1368s21c1
Sequence:CCGGCTGGAAAGCATGTAGTATAAACTCGAGTTTATACTACATGCTTTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178891.4-892s21c1
Sequence:CCGGCATGGTTTCGCCGTCTGGTTTCTCGAGAAACCAGACGGCGAAACCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097494    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178891.3-1538s1c1
Sequence:CCGGCCCTCCTCATACCATTTATTTCTCGAGAAATAAATGGTATGAGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178891.3-1005s1c1
Sequence:CCGGGTGGAACAAGATACGGACATTCTCGAGAATGTCCGTATCTTGTTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178891.3-662s1c1
Sequence:CCGGCGTGGATATGAGCTGCATGGACTCGAGTCCATGCAGCTCATATCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178891.3-146s1c1
Sequence:CCGGCCAGCTGTACTACGAGTGCTACTCGAGTAGCACTCGTAGTACAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178891.3-1074s1c1
Sequence:CCGGCGCATACTTCTGCGCTACAAACTCGAGTTTGTAGCGCAGAAGTATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks