EMAIL THIS PAGE TO A FRIEND

PRNP

prion protein

Synonyms: ASCR AltPrP CD230 CJD GSS KURU PRIP PrP PrP27-30 PrP33-35C PrPc p27-30
Gene ID:
Human(5621) Summary: The protein encoded by this gene is a membrane glycosylphosphatidylinositol-anchored glycoprotein that tends to aggregate into rod-like structures. The encoded protein contains a highly unstable region of five tandem octapeptide repeats. This gene is found on chromosome 20, approximately 20 kbp upstream of a gene which encodes a biochemically and structurally similar protein to the one encoded by this gene. Mutations in the repeat region as well as elsewhere in this gene have been associated with Creutzfeldt-Jakob disease, fatal familial insomnia, Gerstmann-Straussler disease, Huntington disease-like 1, and kuru. An overlapping open reading frame has been found for this gene that encodes a smaller, structurally unrelated protein, AltPrp. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2012]
Mouse(19122) prion protein
Rat(24686) prion protein
cow(281427) prion protein
sheep(493887) prion protein
chicken(396452) prion protein
dog(485783) prion protein
Horse(100065904) prion protein
domestic cat(493886) prion protein
173 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Antagonist

Product # Description Species Add to Cart
 
P13207 Phenazine 98% human pricing
C4024 Carbamazepine powder human, rat pricing
C8981 Carbamazepine meets USP testing specifications human, rat pricing
H1512 Haloperidol powder human, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011170 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011170 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011170 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000311 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000311 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000311 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU046551 MISSION® esiRNA esiRNA human PRNP (esiRNA1) human pricing

Related Products

Product # Description Species Add to Cart
 
MABN1839 Anti-Amyloid-β (oligomer) Antibody, clone F11G3 100 μg, This Anti-Amyloid-β (oligomer) Antibody, clone F11G3 is validated for use in Western Blotting, Dot Blot, ELISA, Immunofluorescence, Immunoprecipitation for the detection of Amyloid-β. pricing
MAB5424 Anti-Prion Protein Antibody 100 µg, Anti-Prion Protein Antibody is an antibody against Prion Protein for use in ELISA, WB, IH. pricing
MAB1562 Anti-Prion Protein Antibody, a.a. 109-112, clone 3F4 100 µg, This Anti-Prion Protein Antibody, a.a. 109-112, clone 3F4 is validated for use in ELISA, IH, IH(P), IP, WB for the detection of Prion Protein. pricing
MABN1186 Anti-Prion Protein Antibody, clone 12D6.1 100 μg, This Anti-Prion Protein Antibody, clone 12D6.1 is validated for use in Western Blotting, Immunohistochemistry (Paraffin) for the detection of Prion Protein. pricing
AB5058 Anti-Prion Protein Antibody, NT, a.a. 78-97 200 µL, Anti-Prion Protein Antibody, N-terminus, a.a. 78-97 detects level of Prion Protein & has been published & validated for use in ELISA, WB, IH(P). pricing
MABN780 Anti-PrP, clone DRM1-31 Antibody 100 µg, MABN780 is an antibody against PrP for use in Western Blotting, Immunohistochemistry, ELISA. pricing
MABN772 Anti-PrP, clone DRM1-60 Antibody 100 µg, MABN772 is an antibody against PrP for use in Western Blotting, ELISA, Immunohistochemistry. pricing
MABN768 Anti-PrP, clone DRM2-118 Antibody 100 µg, MABN768 is an antibody against PrP for use in Western Blotting, Immunohistochemistry, ELISA. pricing
AG210 Prion Protein, recombinant 50 µg pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000311 Rosetta Predictions human pricing
NM_001080121 Rosetta Predictions human pricing
NM_001080122 Rosetta Predictions human pricing
NM_001080123 Rosetta Predictions human pricing
NM_183079 Rosetta Predictions human pricing
NM_012631 Rosetta Predictions rat pricing
XM_579340 Rosetta Predictions rat pricing
NM_011170 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000311 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00033378 predicted 1530
2 SASI_Hs02_00302307 predicted 1449
3 SASI_Hs01_00033380 predicted 1502
4 SASI_Hs01_00033381 predicted 1374
5 SASI_Hs01_00033382 predicted 1384
6 SASI_Hs01_00033383 predicted 1353
7 SASI_Hs01_00033384 predicted 1316
8 SASI_Hs01_00033385 predicted 1608
9 SASI_Hs01_00033386 predicted 1239
10 SASI_Hs02_00302308 predicted 1460
11 SASI_Hs01_00033379 predicted 532
12 SASI_Hs01_00033387 predicted 1311
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080121 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00314191 predicted 1518
2 SASI_Hs02_00314192 predicted 790
3 SASI_Hs02_00314193 predicted 1437
4 SASI_Hs02_00314194 predicted 1497
5 SASI_Hs02_00314195 predicted 1367
6 SASI_Hs02_00314196 predicted 1344
7 SASI_Hs02_00314197 predicted 1311
8 SASI_Hs02_00314198 predicted 1233
9 SASI_Hs02_00314199 predicted 798
10 SASI_Hs02_00314200 predicted 1457
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080122 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00314201 predicted 1522
2 SASI_Hs02_00314202 predicted 1437
3 SASI_Hs02_00314203 predicted 1493
4 SASI_Hs02_00314204 predicted 1368
5 SASI_Hs02_00314205 predicted 1376
6 SASI_Hs02_00314206 predicted 1335
7 SASI_Hs02_00314207 predicted 1312
8 SASI_Hs02_00314208 predicted 1600
9 SASI_Hs02_00314209 predicted 1221
10 SASI_Hs02_00314210 predicted 1448
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080123 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00314211 predicted 1387
2 SASI_Hs02_00314212 predicted 1310
3 SASI_Hs02_00314213 predicted 1371
4 SASI_Hs02_00314214 predicted 1235
5 SASI_Hs02_00314215 predicted 1245
6 SASI_Hs02_00314216 predicted 1216
7 SASI_Hs02_00314217 predicted 1182
8 SASI_Hs02_00314218 predicted 1471
9 SASI_Hs02_00314219 predicted 1100
10 SASI_Hs02_00314220 predicted 1320
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183079 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00174602 predicted 1525
2 SASI_Hs01_00174603 predicted 788
3 SASI_Hs02_00371222 predicted 1443
4 SASI_Hs01_00174604 predicted 1500
5 SASI_Hs01_00174605 predicted 1375
6 SASI_Hs01_00174607 predicted 1345
7 SASI_Hs01_00174608 predicted 1317
8 SASI_Hs01_00174610 predicted 1234
9 SASI_Hs02_00371223 predicted 798
10 SASI_Hs02_00371224 predicted 1457
11 SASI_Hs01_00174606 predicted 1116
12 SASI_Hs01_00174609 predicted 1335
13 SASI_Hs01_00174611 predicted 1312
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012631 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00043907 predicted 1113
2 SASI_Rn02_00259855 predicted 1392
3 SASI_Rn01_00043909 predicted 991
4 SASI_Rn01_00043910 predicted 1133
5 SASI_Rn02_00259856 predicted 1031
6 SASI_Rn01_00043911 predicted 1084
7 SASI_Rn01_00043912 predicted 1199
8 SASI_Rn01_00043913 predicted 1096
9 SASI_Rn01_00043914 predicted 1070
10 SASI_Rn01_00043915 predicted 817
11 SASI_Rn01_00043908 predicted 441
12 SASI_Rn01_00043916 predicted 706
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579340 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00145106 predicted 627
2 SASI_Rn01_00145107 predicted 298
3 SASI_Rn01_00145108 predicted 442
4 SASI_Rn01_00145109 predicted 993
5 SASI_Rn01_00145110 predicted 872
6 SASI_Rn01_00145111 predicted 432
7 SASI_Rn01_00145112 predicted 1095
8 SASI_Rn01_00145113 predicted 979
9 SASI_Rn01_00145114 predicted 1110
10 SASI_Rn01_00145115 predicted 1079
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011170 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00320047 predicted 1119
2 SASI_Mm01_00115625 predicted 1018
3 SASI_Mm01_00115626 predicted 1162
4 SASI_Mm01_00115627 predicted 848
5 SASI_Mm01_00115628 predicted 1027
6 SASI_Mm01_00115629 predicted 827
7 SASI_Mm01_00115630 predicted 1164
8 SASI_Mm02_00320048 predicted 1078
9 SASI_Mm02_00320049 predicted 1119
10 SASI_Mm01_00115631 predicted 1001
11 SASI_Mm01_00115632 predicted 736
12 SASI_Mm01_00115633 predicted 645
13 SASI_Mm01_00115634 predicted 1081
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011170
VALIDATED
PRNP MISSION shRNA Bacterial Glycerol Stock
prion protein
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000319687    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011170.2-778s21c1
Sequence:CCGGCGAGACCGATGTGAAGATGATCTCGAGATCATCTTCACATCGGTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273750    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011170.2-646s21c1
Sequence:CCGGCCGCTACCCTAACCAAGTGTACTCGAGTACACTTGGTTAGGGTAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273749    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011170.2-618s21c1
Sequence:CCGGAGGACCGCTACTACCGTGAAACTCGAGTTTCACGGTAGTAGCGGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273803    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011170.2-583s21c1
Sequence:CCGGGAGCAGGCCCATGATCCATTTCTCGAGAAATGGATCATGGGCCTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273801    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011170.2-1025s21c1
Sequence:CCGGCAATTGAGGTGGTTCTCATTCCTCGAGGAATGAGAACCACCTCAATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008468    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011170.1-1772s1c1
Sequence:CCGGGCATTGTTTAAATCAGGCAAACTCGAGTTTGCCTGATTTAAACAATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_011170.1-749s1c1
Sequence:CCGGCGAGACCGATGTGAAGATGATCTCGAGATCATCTTCACATCGGTCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011170.1-683s1c1
Sequence:CCGGCGACTGCGTCAATATCACCATCTCGAGATGGTGATATTGACGCAGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008471    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011170.1-617s1c1
Sequence:CCGGCCGCTACCCTAACCAAGTGTACTCGAGTACACTTGGTTAGGGTAGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008472    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_011170.1-373s1c1
Sequence:CCGGGACAACCTCATGGTGGTAGTTCTCGAGAACTACCACCATGAGGTTGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011170
VALIDATED
PRNP MISSION shRNA shRNA Plasmid DNA
prion protein
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000319687    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011170.2-778s21c1
Sequence:CCGGCGAGACCGATGTGAAGATGATCTCGAGATCATCTTCACATCGGTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273750    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011170.2-646s21c1
Sequence:CCGGCCGCTACCCTAACCAAGTGTACTCGAGTACACTTGGTTAGGGTAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273749    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011170.2-618s21c1
Sequence:CCGGAGGACCGCTACTACCGTGAAACTCGAGTTTCACGGTAGTAGCGGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273803    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011170.2-583s21c1
Sequence:CCGGGAGCAGGCCCATGATCCATTTCTCGAGAAATGGATCATGGGCCTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273801    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011170.2-1025s21c1
Sequence:CCGGCAATTGAGGTGGTTCTCATTCCTCGAGGAATGAGAACCACCTCAATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008468    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011170.1-1772s1c1
Sequence:CCGGGCATTGTTTAAATCAGGCAAACTCGAGTTTGCCTGATTTAAACAATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_011170.1-749s1c1
Sequence:CCGGCGAGACCGATGTGAAGATGATCTCGAGATCATCTTCACATCGGTCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011170.1-683s1c1
Sequence:CCGGCGACTGCGTCAATATCACCATCTCGAGATGGTGATATTGACGCAGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008471    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011170.1-617s1c1
Sequence:CCGGCCGCTACCCTAACCAAGTGTACTCGAGTACACTTGGTTAGGGTAGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008472    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_011170.1-373s1c1
Sequence:CCGGGACAACCTCATGGTGGTAGTTCTCGAGAACTACCACCATGAGGTTGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011170
VALIDATED
PRNP MISSION shRNA Lentiviral Transduction Particles
prion protein
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000319687    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011170.2-778s21c1
Sequence:CCGGCGAGACCGATGTGAAGATGATCTCGAGATCATCTTCACATCGGTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273750    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011170.2-646s21c1
Sequence:CCGGCCGCTACCCTAACCAAGTGTACTCGAGTACACTTGGTTAGGGTAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273749    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011170.2-618s21c1
Sequence:CCGGAGGACCGCTACTACCGTGAAACTCGAGTTTCACGGTAGTAGCGGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273803    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011170.2-583s21c1
Sequence:CCGGGAGCAGGCCCATGATCCATTTCTCGAGAAATGGATCATGGGCCTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273801    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011170.2-1025s21c1
Sequence:CCGGCAATTGAGGTGGTTCTCATTCCTCGAGGAATGAGAACCACCTCAATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008468    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011170.1-1772s1c1
Sequence:CCGGGCATTGTTTAAATCAGGCAAACTCGAGTTTGCCTGATTTAAACAATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_011170.1-749s1c1
Sequence:CCGGCGAGACCGATGTGAAGATGATCTCGAGATCATCTTCACATCGGTCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011170.1-683s1c1
Sequence:CCGGCGACTGCGTCAATATCACCATCTCGAGATGGTGATATTGACGCAGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008471    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011170.1-617s1c1
Sequence:CCGGCCGCTACCCTAACCAAGTGTACTCGAGTACACTTGGTTAGGGTAGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008472    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_011170.1-373s1c1
Sequence:CCGGGACAACCTCATGGTGGTAGTTCTCGAGAACTACCACCATGAGGTTGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000311
VALIDATED
PRNP MISSION shRNA Bacterial Glycerol Stock
prion protein
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000315762    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_000311.3-1522s21c1
Sequence:CCGGGCCCTATCTTAGTAGAGATTTCTCGAGAAATCTCTACTAAGATAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315840    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_000311.3-903s21c1
Sequence:CCGGCGACTGCGTCAATATCACAATCTCGAGATTGTGATATTGACGCAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315764    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_000311.3-663s21c1
Sequence:CCGGTCAGTGGAACAAGCCGAGTAACTCGAGTTACTCGGCTTGTTCCACTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303463    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_000311.3-803s21c1
Sequence:CCGGACTATGAGGACCGTTACTATCCTCGAGGATAGTAACGGTCCTCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000310705    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_000311.3-964s21c1
Sequence:CCGGTTCACCGAGACCGACGTTAAGCTCGAGCTTAACGTCGGTCTCGGTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083488    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_000311.2-1250s1c1
Sequence:CCGGGCCCTATCTTAGTAGAGATTTCTCGAGAAATCTCTACTAAGATAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000311.2-509s1c1
Sequence:CCGGCCCATCATACATTTCGGCAGTCTCGAGACTGCCGAAATGTATGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083492    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_000311.2-391s1c1
Sequence:CCGGTCAGTGGAACAAGCCGAGTAACTCGAGTTACTCGGCTTGTTCCACTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_000311.2-634s1c1
Sequence:CCGGCTGCGTCAATATCACAATCAACTCGAGTTGATTGTGATATTGACGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083489    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_000311.2-631s1c1
Sequence:CCGGCGACTGCGTCAATATCACAATCTCGAGATTGTGATATTGACGCAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000311
VALIDATED
PRNP MISSION shRNA shRNA Plasmid DNA
prion protein
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000315762    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_000311.3-1522s21c1
Sequence:CCGGGCCCTATCTTAGTAGAGATTTCTCGAGAAATCTCTACTAAGATAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315840    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_000311.3-903s21c1
Sequence:CCGGCGACTGCGTCAATATCACAATCTCGAGATTGTGATATTGACGCAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315764    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_000311.3-663s21c1
Sequence:CCGGTCAGTGGAACAAGCCGAGTAACTCGAGTTACTCGGCTTGTTCCACTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303463    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_000311.3-803s21c1
Sequence:CCGGACTATGAGGACCGTTACTATCCTCGAGGATAGTAACGGTCCTCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000310705    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_000311.3-964s21c1
Sequence:CCGGTTCACCGAGACCGACGTTAAGCTCGAGCTTAACGTCGGTCTCGGTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083488    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_000311.2-1250s1c1
Sequence:CCGGGCCCTATCTTAGTAGAGATTTCTCGAGAAATCTCTACTAAGATAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000311.2-509s1c1
Sequence:CCGGCCCATCATACATTTCGGCAGTCTCGAGACTGCCGAAATGTATGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083492    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_000311.2-391s1c1
Sequence:CCGGTCAGTGGAACAAGCCGAGTAACTCGAGTTACTCGGCTTGTTCCACTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_000311.2-634s1c1
Sequence:CCGGCTGCGTCAATATCACAATCAACTCGAGTTGATTGTGATATTGACGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083489    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_000311.2-631s1c1
Sequence:CCGGCGACTGCGTCAATATCACAATCTCGAGATTGTGATATTGACGCAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000311
VALIDATED
PRNP MISSION shRNA Lentiviral Transduction Particles
prion protein
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000315762    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_000311.3-1522s21c1
Sequence:CCGGGCCCTATCTTAGTAGAGATTTCTCGAGAAATCTCTACTAAGATAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315840    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_000311.3-903s21c1
Sequence:CCGGCGACTGCGTCAATATCACAATCTCGAGATTGTGATATTGACGCAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315764    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_000311.3-663s21c1
Sequence:CCGGTCAGTGGAACAAGCCGAGTAACTCGAGTTACTCGGCTTGTTCCACTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303463    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_000311.3-803s21c1
Sequence:CCGGACTATGAGGACCGTTACTATCCTCGAGGATAGTAACGGTCCTCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000310705    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_000311.3-964s21c1
Sequence:CCGGTTCACCGAGACCGACGTTAAGCTCGAGCTTAACGTCGGTCTCGGTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083488    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_000311.2-1250s1c1
Sequence:CCGGGCCCTATCTTAGTAGAGATTTCTCGAGAAATCTCTACTAAGATAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000311.2-509s1c1
Sequence:CCGGCCCATCATACATTTCGGCAGTCTCGAGACTGCCGAAATGTATGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083492    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_000311.2-391s1c1
Sequence:CCGGTCAGTGGAACAAGCCGAGTAACTCGAGTTACTCGGCTTGTTCCACTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_000311.2-634s1c1
Sequence:CCGGCTGCGTCAATATCACAATCAACTCGAGTTGATTGTGATATTGACGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083489    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_000311.2-631s1c1
Sequence:CCGGCGACTGCGTCAATATCACAATCTCGAGATTGTGATATTGACGCAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks