EMAIL THIS PAGE TO A FRIEND

PROKR2

prokineticin receptor 2

Synonyms: GPR73L1 GPR73b GPRg2 HH3 KAL3 PKR2 dJ680N4.3
UniProtKB ID: Q8NFJ6, A5JUU1, Q2M3C0, Q5TDY1, Q9NTT0
Gene ID:
Human(128674) Summary: Prokineticins are secreted proteins that can promote angiogenesis and induce strong gastrointestinal smooth muscle contraction. The protein encoded by this gene is an integral membrane protein and G protein-coupled receptor for prokineticins. The encoded protein is similar in sequence to GPR73, another G protein-coupled receptor for prokineticins. [provided by RefSeq, Jul 2008]
Mouse(246313) prokineticin receptor 2
Rat(192649) prokineticin receptor 2
chicken(421263) prokineticin receptor 2
dog(485779) prokineticin receptor 2
domestic cat(101080960) prokineticin receptor 2
Horse(100052008) prokineticin receptor 2
Domestic Rabbit(100339634) prokineticin receptor 2
naked mole-rat(101714941) prokineticin receptor 2
domestic guinea pig(100713590) prokineticin receptor 2
cow(282431) prokineticin receptor 2
sheep(101114889) prokineticin receptor 2
52 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144773 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_144773 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_144773 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_144944 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_144944 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_144944 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_144773 Rosetta Predictions human pricing
NM_138978 Rosetta Predictions rat pricing
NM_144944 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144773 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00154834 predicted 570
2 SASI_Hs01_00154835 predicted 255
3 SASI_Hs01_00154836 predicted 403
4 SASI_Hs01_00154837 predicted 435
5 SASI_Hs01_00154838 predicted 373
6 SASI_Hs01_00154840 predicted 546
7 SASI_Hs02_00364719 predicted 236
8 SASI_Hs01_00154841 predicted 200
9 SASI_Hs02_00364720 predicted 542
10 SASI_Hs01_00154842 predicted 479
11 SASI_Hs01_00154839 predicted 811
12 SASI_Hs01_00154843 predicted 438
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138978 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00044478 predicted 481
2 SASI_Rn02_00268411 predicted 522
3 SASI_Rn01_00044479 predicted 919
4 SASI_Rn01_00044480 predicted 986
5 SASI_Rn01_00044481 predicted 686
6 SASI_Rn01_00044482 predicted 681
7 SASI_Rn01_00044483 predicted 369
8 SASI_Rn01_00044484 predicted 911
9 SASI_Rn01_00044485 predicted 557
10 SASI_Rn01_00044486 predicted 626
11 SASI_Rn01_00044487 predicted 552
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144944 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00048323 predicted 632
2 SASI_Mm01_00048324 predicted 1391
3 SASI_Mm01_00048325 predicted 847
4 SASI_Mm01_00048326 predicted 1135
5 SASI_Mm01_00048327 predicted 341
6 SASI_Mm01_00048328 predicted 1457
7 SASI_Mm01_00048329 predicted 774
8 SASI_Mm01_00048330 predicted 841
9 SASI_Mm01_00048331 predicted 730
10 SASI_Mm01_00048332 predicted 300
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144773
PROKR2 MISSION shRNA Bacterial Glycerol Stock
prokineticin receptor 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000367766    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144773.2-481s21c1
Sequence:CCGGTTGAAACCACGGATGAATTATCTCGAGATAATTCATCCGTGGTTTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144773.2-80s21c1
Sequence:CCGGACTTCAGTTATGGTGATTATGCTCGAGCATAATCACCATAACTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357267    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144773.2-554s21c1
Sequence:CCGGCCATCCCATCGGCTTACTTTGCTCGAGCAAAGTAAGCCGATGGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144773.2-574s1c1
Sequence:CCGGGCAACAGAAACGGTCCTCTTTCTCGAGAAAGAGGACCGTTTCTGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144773.2-542s1c1
Sequence:CCGGCCATTCTCATTGCCATCCCATCTCGAGATGGGATGGCAATGAGAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144773.2-479s1c1
Sequence:CCGGCCTTGAAACCACGGATGAATTCTCGAGAATTCATCCGTGGTTTCAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144773.2-154s1c1
Sequence:CCGGGCCAAGATCGTCATTGGCATTCTCGAGAATGCCAATGACGATCTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144773
PROKR2 MISSION shRNA shRNA Plasmid DNA
prokineticin receptor 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000367766    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144773.2-481s21c1
Sequence:CCGGTTGAAACCACGGATGAATTATCTCGAGATAATTCATCCGTGGTTTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144773.2-80s21c1
Sequence:CCGGACTTCAGTTATGGTGATTATGCTCGAGCATAATCACCATAACTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357267    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144773.2-554s21c1
Sequence:CCGGCCATCCCATCGGCTTACTTTGCTCGAGCAAAGTAAGCCGATGGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144773.2-574s1c1
Sequence:CCGGGCAACAGAAACGGTCCTCTTTCTCGAGAAAGAGGACCGTTTCTGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144773.2-542s1c1
Sequence:CCGGCCATTCTCATTGCCATCCCATCTCGAGATGGGATGGCAATGAGAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144773.2-479s1c1
Sequence:CCGGCCTTGAAACCACGGATGAATTCTCGAGAATTCATCCGTGGTTTCAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144773.2-154s1c1
Sequence:CCGGGCCAAGATCGTCATTGGCATTCTCGAGAATGCCAATGACGATCTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144773
PROKR2 MISSION shRNA Lentiviral Transduction Particles
prokineticin receptor 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000367766    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144773.2-481s21c1
Sequence:CCGGTTGAAACCACGGATGAATTATCTCGAGATAATTCATCCGTGGTTTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144773.2-80s21c1
Sequence:CCGGACTTCAGTTATGGTGATTATGCTCGAGCATAATCACCATAACTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357267    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144773.2-554s21c1
Sequence:CCGGCCATCCCATCGGCTTACTTTGCTCGAGCAAAGTAAGCCGATGGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144773.2-574s1c1
Sequence:CCGGGCAACAGAAACGGTCCTCTTTCTCGAGAAAGAGGACCGTTTCTGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144773.2-542s1c1
Sequence:CCGGCCATTCTCATTGCCATCCCATCTCGAGATGGGATGGCAATGAGAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144773.2-479s1c1
Sequence:CCGGCCTTGAAACCACGGATGAATTCTCGAGAATTCATCCGTGGTTTCAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144773.2-154s1c1
Sequence:CCGGGCCAAGATCGTCATTGGCATTCTCGAGAATGCCAATGACGATCTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144944
PROKR2 MISSION shRNA Bacterial Glycerol Stock
prokineticin receptor 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000028744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144944.2-1134s1c1
Sequence:CCGGCCGTTCTATGGCTTTACCATACTCGAGTATGGTAAAGCCATAGAACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144944.2-841s1c1
Sequence:CCGGCCACAGAAACCATCCTCGTTACTCGAGTAACGAGGATGGTTTCTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144944.2-325s1c1
Sequence:CCGGCCCAAGACCATGTCTCCTTAACTCGAGTTAAGGAGACATGGTCTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144944.2-917s1c1
Sequence:CCGGGCTCTACTACAAATCCTACTTCTCGAGAAGTAGGATTTGTAGTAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144944.2-1396s1c1
Sequence:CCGGAGGTGGATTGTATCAGACTAACTCGAGTTAGTCTGATACAATCCACCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144944
PROKR2 MISSION shRNA shRNA Plasmid DNA
prokineticin receptor 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000028744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144944.2-1134s1c1
Sequence:CCGGCCGTTCTATGGCTTTACCATACTCGAGTATGGTAAAGCCATAGAACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144944.2-841s1c1
Sequence:CCGGCCACAGAAACCATCCTCGTTACTCGAGTAACGAGGATGGTTTCTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144944.2-325s1c1
Sequence:CCGGCCCAAGACCATGTCTCCTTAACTCGAGTTAAGGAGACATGGTCTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144944.2-917s1c1
Sequence:CCGGGCTCTACTACAAATCCTACTTCTCGAGAAGTAGGATTTGTAGTAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144944.2-1396s1c1
Sequence:CCGGAGGTGGATTGTATCAGACTAACTCGAGTTAGTCTGATACAATCCACCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144944
PROKR2 MISSION shRNA Lentiviral Transduction Particles
prokineticin receptor 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000028744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144944.2-1134s1c1
Sequence:CCGGCCGTTCTATGGCTTTACCATACTCGAGTATGGTAAAGCCATAGAACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144944.2-841s1c1
Sequence:CCGGCCACAGAAACCATCCTCGTTACTCGAGTAACGAGGATGGTTTCTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144944.2-325s1c1
Sequence:CCGGCCCAAGACCATGTCTCCTTAACTCGAGTTAAGGAGACATGGTCTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144944.2-917s1c1
Sequence:CCGGGCTCTACTACAAATCCTACTTCTCGAGAAGTAGGATTTGTAGTAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144944.2-1396s1c1
Sequence:CCGGAGGTGGATTGTATCAGACTAACTCGAGTTAGTCTGATACAATCCACCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks