EMAIL THIS PAGE TO A FRIEND

PROL1

proline rich, lacrimal 1

Synonyms: BPLP PRL1 opiorphin
UniProtKB ID: Q99935, A8MZ07, P85047
Gene ID:
Human(58503) Summary: This gene encodes a member of the proline-rich protein family. The protein may provide a protective function at the eye surface. [provided by RefSeq, Jul 2008]
Mouse(17830) proline rich, lacrimal 1
Rat(65182) proline rich, lacrimal 1
58 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021225 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021225 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021225 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008644 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008644 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008644 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU000601 MISSION® esiRNA esiRNA targeting human PROL1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021225 Rosetta Predictions human pricing
NM_133513 Rosetta Predictions rat pricing
NM_008644 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021225 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00220350 predicted 498
2 SASI_Hs02_00354841 predicted 416
3 SASI_Hs01_00220352 predicted 326
4 SASI_Hs01_00220357 predicted 412
5 SASI_Hs02_00354842 predicted 612
6 SASI_Hs02_00354843 predicted 421
7 SASI_Hs02_00354844 predicted 231
8 SASI_Hs02_00354845 predicted 498
9 SASI_Hs02_00354846 predicted 390
10 SASI_Hs02_00354847 predicted 609
11 SASI_Hs01_00220351 predicted 231
12 SASI_Hs01_00220353 predicted 287
13 SASI_Hs01_00220354 predicted 348
14 SASI_Hs01_00220355 predicted 587
15 SASI_Hs01_00220356 predicted 286
16 SASI_Hs01_00220358 predicted 285
17 SASI_Hs01_00220359 predicted 711
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133513 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00117638 predicted 265
2 SASI_Rn01_00117639 predicted 274
3 SASI_Rn02_00267693 predicted 268
4 SASI_Rn01_00117640 predicted 278
5 SASI_Rn01_00117641 predicted 283
6 SASI_Rn01_00117642 predicted 223
7 SASI_Rn01_00117643 predicted 285
8 SASI_Rn01_00117644 predicted 230
9 SASI_Rn01_00117645 predicted 217
10 SASI_Rn01_00117646 predicted 264
11 SASI_Rn01_00117647 predicted 289
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008644 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00029380 predicted 208
2 SASI_Mm01_00029382 predicted 234
3 SASI_Mm02_00314366 predicted 318
4 SASI_Mm02_00314367 predicted 251
5 SASI_Mm01_00029383 predicted 290
6 SASI_Mm02_00314368 predicted 418
7 SASI_Mm01_00029385 predicted 321
8 SASI_Mm02_00314369 predicted 344
9 SASI_Mm02_00314370 predicted 318
10 SASI_Mm02_00314371 predicted 203
11 SASI_Mm01_00029381 predicted 342
12 SASI_Mm01_00029384 predicted 241
13 SASI_Mm01_00029386 predicted 247
14 SASI_Mm01_00029387 predicted 345
15 SASI_Mm01_00029388 predicted 294
16 SASI_Mm01_00029389 predicted 342
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021225
PROL1 MISSION shRNA Bacterial Glycerol Stock
proline rich, lacrimal 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021225.1-596s1c1
Sequence:CCGGCAATGACGATCAGCTCCTCAACTCGAGTTGAGGAGCTGATCGTCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137599    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021225.1-744s1c1
Sequence:CCGGCCAAGTTACGACTTCCAACCACTCGAGTGGTTGGAAGTCGTAACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021225.1-523s1c1
Sequence:CCGGCCGCAGATACAACAATCACCACTCGAGTGGTGATTGTTGTATCTGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138144    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021225.1-284s1c1
Sequence:CCGGGCGAGTTCCACCATCTTCTTTCTCGAGAAAGAAGATGGTGGAACTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021225.1-606s1c1
Sequence:CCGGCAGCTCCTCAACAGTACCTATCTCGAGATAGGTACTGTTGAGGAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021225.1-611s1c1
Sequence:CCGGCCTCAACAGTACCTATCTCTTCTCGAGAAGAGATAGGTACTGTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135187    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021225.1-309s1c1
Sequence:CCGGCGATTTAGCCAAGCAGTCATTCTCGAGAATGACTGCTTGGCTAAATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135310    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021225.1-446s1c1
Sequence:CCGGCCCATTTCCTCCTATTCCTTTCTCGAGAAAGGAATAGGAGGAAATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021225
PROL1 MISSION shRNA shRNA Plasmid DNA
proline rich, lacrimal 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021225.1-596s1c1
Sequence:CCGGCAATGACGATCAGCTCCTCAACTCGAGTTGAGGAGCTGATCGTCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137599    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021225.1-744s1c1
Sequence:CCGGCCAAGTTACGACTTCCAACCACTCGAGTGGTTGGAAGTCGTAACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021225.1-523s1c1
Sequence:CCGGCCGCAGATACAACAATCACCACTCGAGTGGTGATTGTTGTATCTGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138144    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021225.1-284s1c1
Sequence:CCGGGCGAGTTCCACCATCTTCTTTCTCGAGAAAGAAGATGGTGGAACTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021225.1-606s1c1
Sequence:CCGGCAGCTCCTCAACAGTACCTATCTCGAGATAGGTACTGTTGAGGAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021225.1-611s1c1
Sequence:CCGGCCTCAACAGTACCTATCTCTTCTCGAGAAGAGATAGGTACTGTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135187    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021225.1-309s1c1
Sequence:CCGGCGATTTAGCCAAGCAGTCATTCTCGAGAATGACTGCTTGGCTAAATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135310    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021225.1-446s1c1
Sequence:CCGGCCCATTTCCTCCTATTCCTTTCTCGAGAAAGGAATAGGAGGAAATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021225
PROL1 MISSION shRNA Lentiviral Transduction Particles
proline rich, lacrimal 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021225.1-596s1c1
Sequence:CCGGCAATGACGATCAGCTCCTCAACTCGAGTTGAGGAGCTGATCGTCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137599    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021225.1-744s1c1
Sequence:CCGGCCAAGTTACGACTTCCAACCACTCGAGTGGTTGGAAGTCGTAACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021225.1-523s1c1
Sequence:CCGGCCGCAGATACAACAATCACCACTCGAGTGGTGATTGTTGTATCTGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138144    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021225.1-284s1c1
Sequence:CCGGGCGAGTTCCACCATCTTCTTTCTCGAGAAAGAAGATGGTGGAACTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021225.1-606s1c1
Sequence:CCGGCAGCTCCTCAACAGTACCTATCTCGAGATAGGTACTGTTGAGGAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021225.1-611s1c1
Sequence:CCGGCCTCAACAGTACCTATCTCTTCTCGAGAAGAGATAGGTACTGTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135187    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021225.1-309s1c1
Sequence:CCGGCGATTTAGCCAAGCAGTCATTCTCGAGAATGACTGCTTGGCTAAATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135310    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021225.1-446s1c1
Sequence:CCGGCCCATTTCCTCCTATTCCTTTCTCGAGAAAGGAATAGGAGGAAATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008644
PROL1 MISSION shRNA Bacterial Glycerol Stock
proline rich, lacrimal 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000189710    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008644.1-467s1c1
Sequence:CCGGGACCCTCAAACCTACCACAAACTCGAGTTTGTGGTAGGTTTGAGGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257623    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008644.2-173s21c1
Sequence:CCGGCAAGTCAAGAAGTTCACAATTCTCGAGAATTGTGAACTTCTTGACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008644.2-585s21c1
Sequence:CCGGACCCTCAAACCTACCACAAATCTCGAGATTTGTGGTAGGTTTGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008644.2-342s21c1
Sequence:CCGGAGTCGCCGTTCTCCTAAATTTCTCGAGAAATTTAGGAGAACGGCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247238    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008644.2-131s21c1
Sequence:CCGGGTTGGCTCTTACTTCATATTTCTCGAGAAATATGAAGTAAGAGCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008644.2-231s21c1
Sequence:CCGGAGATATCCAAGACCACATTATCTCGAGATAATGTGGTCTTGGATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215621    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008644.2-131s1c1
Sequence:CCGGGTTGGCTCTTACTTCATATTTCTCGAGAAATATGAAGTAAGAGCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215804    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008644.2-173s1c1
Sequence:CCGGCAAGTCAAGAAGTTCACAATTCTCGAGAATTGTGAACTTCTTGACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008644
PROL1 MISSION shRNA shRNA Plasmid DNA
proline rich, lacrimal 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000189710    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008644.1-467s1c1
Sequence:CCGGGACCCTCAAACCTACCACAAACTCGAGTTTGTGGTAGGTTTGAGGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257623    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008644.2-173s21c1
Sequence:CCGGCAAGTCAAGAAGTTCACAATTCTCGAGAATTGTGAACTTCTTGACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008644.2-585s21c1
Sequence:CCGGACCCTCAAACCTACCACAAATCTCGAGATTTGTGGTAGGTTTGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008644.2-342s21c1
Sequence:CCGGAGTCGCCGTTCTCCTAAATTTCTCGAGAAATTTAGGAGAACGGCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247238    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008644.2-131s21c1
Sequence:CCGGGTTGGCTCTTACTTCATATTTCTCGAGAAATATGAAGTAAGAGCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008644.2-231s21c1
Sequence:CCGGAGATATCCAAGACCACATTATCTCGAGATAATGTGGTCTTGGATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215621    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008644.2-131s1c1
Sequence:CCGGGTTGGCTCTTACTTCATATTTCTCGAGAAATATGAAGTAAGAGCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215804    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008644.2-173s1c1
Sequence:CCGGCAAGTCAAGAAGTTCACAATTCTCGAGAATTGTGAACTTCTTGACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008644
PROL1 MISSION shRNA Lentiviral Transduction Particles
proline rich, lacrimal 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000189710    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008644.1-467s1c1
Sequence:CCGGGACCCTCAAACCTACCACAAACTCGAGTTTGTGGTAGGTTTGAGGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257623    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008644.2-173s21c1
Sequence:CCGGCAAGTCAAGAAGTTCACAATTCTCGAGAATTGTGAACTTCTTGACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008644.2-585s21c1
Sequence:CCGGACCCTCAAACCTACCACAAATCTCGAGATTTGTGGTAGGTTTGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008644.2-342s21c1
Sequence:CCGGAGTCGCCGTTCTCCTAAATTTCTCGAGAAATTTAGGAGAACGGCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247238    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008644.2-131s21c1
Sequence:CCGGGTTGGCTCTTACTTCATATTTCTCGAGAAATATGAAGTAAGAGCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008644.2-231s21c1
Sequence:CCGGAGATATCCAAGACCACATTATCTCGAGATAATGTGGTCTTGGATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215621    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008644.2-131s1c1
Sequence:CCGGGTTGGCTCTTACTTCATATTTCTCGAGAAATATGAAGTAAGAGCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215804    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008644.2-173s1c1
Sequence:CCGGCAAGTCAAGAAGTTCACAATTCTCGAGAATTGTGAACTTCTTGACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks