EMAIL THIS PAGE TO A FRIEND

PROM2

prominin 2

Synonyms: PROML2
UniProtKB ID: Q8N271, A8K2V1, Q2HIX6, Q8NB84, Q8TAE2
Gene ID:
Human(150696) Summary: This gene encodes a member of the prominin family of pentaspan membrane glycoproteins. The encoded protein localizes to basal epithelial cells and may be involved in the organization of plasma membrane microdomains. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
Mouse(192212) prominin 2
Rat(192211) prominin 2
Zebrafish(556596) prominin 2
chicken(428200) prominin 2
dog(611664) prominin 2
cow(520936) prominin 2
sheep(101116471) prominin 2
57 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_138750 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_138750 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_138750 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_144707 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_144707 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_144707 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU091311 MISSION® esiRNA esiRNA human PROM2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_144707 Rosetta Predictions human pricing
NM_138857 Rosetta Predictions rat pricing
NM_138750 Rosetta Predictions mouse pricing
NM_178047 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144707 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00174572 predicted 2831
2 SASI_Hs01_00174573 predicted 924
3 SASI_Hs01_00174574 predicted 1843
4 SASI_Hs01_00174575 predicted 2546
5 SASI_Hs01_00174576 predicted 2431
6 SASI_Hs01_00174577 predicted 2808
7 SASI_Hs01_00174578 predicted 2234
8 SASI_Hs01_00174579 predicted 1852
9 SASI_Hs01_00174580 predicted 928
10 SASI_Hs01_00174581 predicted 2522
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138857 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00268262 predicted 2770
2 SASI_Rn01_00121165 predicted 371
3 SASI_Rn01_00121166 predicted 2320
4 SASI_Rn01_00121167 predicted 1185
5 SASI_Rn01_00121168 predicted 2228
6 SASI_Rn01_00121169 predicted 1797
7 SASI_Rn01_00121170 predicted 807
8 SASI_Rn01_00121171 predicted 2052
9 SASI_Rn01_00121172 predicted 1889
10 SASI_Rn02_00268263 predicted 2198
11 SASI_Rn01_00121164 predicted 1380
12 SASI_Rn01_00121173 predicted 461
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138750 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00104359 predicted 594
2 SASI_Mm01_00104360 predicted 1452
3 SASI_Mm01_00104361 predicted 1404
4 SASI_Mm01_00104362 predicted 1382
5 SASI_Mm01_00104363 predicted 456
6 SASI_Mm01_00104364 predicted 554
7 SASI_Mm01_00104365 predicted 490
8 SASI_Mm01_00104366 predicted 348
9 SASI_Mm01_00104367 predicted 396
10 SASI_Mm01_00104368 predicted 329
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178047 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00070353 predicted 1242
2 SASI_Mm01_00070354 predicted 1384
3 SASI_Mm01_00070355 predicted 1339
4 SASI_Mm01_00070356 predicted 1314
5 SASI_Mm01_00070357 predicted 1323
6 SASI_Mm01_00070358 predicted 1172
7 SASI_Mm01_00070359 predicted 1328
8 SASI_Mm01_00070360 predicted 1228
9 SASI_Mm01_00070361 predicted 1156
10 SASI_Mm01_00070362 predicted 1481
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138750
PROM2 MISSION shRNA Bacterial Glycerol Stock
prominin 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000115311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138750.1-1729s1c1
Sequence:CCGGCCATCCATGAACCTATCCTATCTCGAGATAGGATAGGTTCATGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138750.1-852s1c1
Sequence:CCGGCGTAATTCATAACCGGCTCAACTCGAGTTGAGCCGGTTATGAATTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138750.1-2600s1c1
Sequence:CCGGGCTCTGAAGAGACACAACTTTCTCGAGAAAGTTGTGTCTCTTCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138750.1-2599s1c1
Sequence:CCGGAGCTCTGAAGAGACACAACTTCTCGAGAAGTTGTGTCTCTTCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138750.1-2544s1c1
Sequence:CCGGCGCTGTCAAGACCTCCAAATACTCGAGTATTTGGAGGTCTTGACAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138750
PROM2 MISSION shRNA shRNA Plasmid DNA
prominin 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000115311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138750.1-1729s1c1
Sequence:CCGGCCATCCATGAACCTATCCTATCTCGAGATAGGATAGGTTCATGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138750.1-852s1c1
Sequence:CCGGCGTAATTCATAACCGGCTCAACTCGAGTTGAGCCGGTTATGAATTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138750.1-2600s1c1
Sequence:CCGGGCTCTGAAGAGACACAACTTTCTCGAGAAAGTTGTGTCTCTTCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138750.1-2599s1c1
Sequence:CCGGAGCTCTGAAGAGACACAACTTCTCGAGAAGTTGTGTCTCTTCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138750.1-2544s1c1
Sequence:CCGGCGCTGTCAAGACCTCCAAATACTCGAGTATTTGGAGGTCTTGACAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138750
PROM2 MISSION shRNA Lentiviral Transduction Particles
prominin 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000115311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138750.1-1729s1c1
Sequence:CCGGCCATCCATGAACCTATCCTATCTCGAGATAGGATAGGTTCATGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138750.1-852s1c1
Sequence:CCGGCGTAATTCATAACCGGCTCAACTCGAGTTGAGCCGGTTATGAATTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138750.1-2600s1c1
Sequence:CCGGGCTCTGAAGAGACACAACTTTCTCGAGAAAGTTGTGTCTCTTCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138750.1-2599s1c1
Sequence:CCGGAGCTCTGAAGAGACACAACTTCTCGAGAAGTTGTGTCTCTTCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138750.1-2544s1c1
Sequence:CCGGCGCTGTCAAGACCTCCAAATACTCGAGTATTTGGAGGTCTTGACAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144707
PROM2 MISSION shRNA Bacterial Glycerol Stock
prominin 2
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166447    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144707.1-2538s1c1
Sequence:CCGGCCTCCAAATACTTCCGTCCTACTCGAGTAGGACGGAAGTATTTGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165765    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144707.1-365s1c1
Sequence:CCGGCCTTTCCCTTCAGAGTTGGTACTCGAGTACCAACTCTGAAGGGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160170    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144707.1-3289s1c1
Sequence:CCGGCCTCTATTCAAAGGCAGAAATCTCGAGATTTCTGCCTTTGAATAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165090    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144707.1-1893s1c1
Sequence:CCGGGCCTGAAAGTAGACACACAGACTCGAGTCTGTGTGTCTACTTTCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165855    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144707.1-1843s1c1
Sequence:CCGGGCACCTGGATATCAACCAGTACTCGAGTACTGGTTGATATCCAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420256    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144707.2-2796s21c1
Sequence:CCGGACAGACCTCAGATCCATTAAACTCGAGTTTAATGGATCTGAGGTCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144707
PROM2 MISSION shRNA shRNA Plasmid DNA
prominin 2
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166447    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144707.1-2538s1c1
Sequence:CCGGCCTCCAAATACTTCCGTCCTACTCGAGTAGGACGGAAGTATTTGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165765    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144707.1-365s1c1
Sequence:CCGGCCTTTCCCTTCAGAGTTGGTACTCGAGTACCAACTCTGAAGGGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160170    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144707.1-3289s1c1
Sequence:CCGGCCTCTATTCAAAGGCAGAAATCTCGAGATTTCTGCCTTTGAATAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165090    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144707.1-1893s1c1
Sequence:CCGGGCCTGAAAGTAGACACACAGACTCGAGTCTGTGTGTCTACTTTCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165855    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144707.1-1843s1c1
Sequence:CCGGGCACCTGGATATCAACCAGTACTCGAGTACTGGTTGATATCCAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420256    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144707.2-2796s21c1
Sequence:CCGGACAGACCTCAGATCCATTAAACTCGAGTTTAATGGATCTGAGGTCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144707
PROM2 MISSION shRNA Lentiviral Transduction Particles
prominin 2
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166447    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144707.1-2538s1c1
Sequence:CCGGCCTCCAAATACTTCCGTCCTACTCGAGTAGGACGGAAGTATTTGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165765    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144707.1-365s1c1
Sequence:CCGGCCTTTCCCTTCAGAGTTGGTACTCGAGTACCAACTCTGAAGGGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160170    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144707.1-3289s1c1
Sequence:CCGGCCTCTATTCAAAGGCAGAAATCTCGAGATTTCTGCCTTTGAATAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165090    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144707.1-1893s1c1
Sequence:CCGGGCCTGAAAGTAGACACACAGACTCGAGTCTGTGTGTCTACTTTCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165855    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144707.1-1843s1c1
Sequence:CCGGGCACCTGGATATCAACCAGTACTCGAGTACTGGTTGATATCCAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420256    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144707.2-2796s21c1
Sequence:CCGGACAGACCTCAGATCCATTAAACTCGAGTTTAATGGATCTGAGGTCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks