EMAIL THIS PAGE TO A FRIEND

PROP1

PROP paired-like homeobox 1

Synonyms: CPHD2 PROP-1
UniProtKB ID: O75360
Gene ID:
Human(5626) Summary: This gene encodes a paired-like homeodomain transcription factor in the developing pituitary gland. Expression occurs prior to and is required for expression of pou domain transcription factor 1, which is responsible for pituitary development and hormone expression. Mutations in this gene have been associated with combined pituitary hormone deficiency-2 as well as deficiencies in luteinizing hormone, follicle-stimulating hormone, growth hormone, prolactin, and thyroid-stimulating hormone. [provided by RefSeq, Sep 2011]
Mouse(19127) paired like homeodomain factor 1
Rat(266738) PROP paired-like homeobox 1
Zebrafish(100001377) PROP paired-like homeobox 1
dog(474647) PROP paired-like homeobox 1
chicken(374220) PROP paired-like homeobox 1
cow(282563) PROP paired-like homeobox 1
sheep(443290) PROP paired-like homeobox 1
60 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006261 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006261 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006261 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008936 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008936 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008936 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006261 Rosetta Predictions human pricing
NM_153627 Rosetta Predictions rat pricing
NM_008936 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006261 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00028602 predicted 588
2 SASI_Hs01_00028603 predicted 1220
3 SASI_Hs01_00028604 predicted 557
4 SASI_Hs01_00028606 predicted 1199
5 SASI_Hs01_00028607 predicted 603
6 SASI_Hs02_00341208 predicted 565
7 SASI_Hs01_00028609 predicted 1175
8 SASI_Hs01_00028610 predicted 665
9 SASI_Hs02_00341209 predicted 534
10 SASI_Hs02_00341210 predicted 359
11 SASI_Hs01_00028601 predicted 1236
12 SASI_Hs01_00028605 predicted 572
13 SASI_Hs01_00028608 predicted 371
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153627 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00039192 predicted 412
2 SASI_Rn01_00039193 predicted 250
3 SASI_Rn01_00039194 predicted 348
4 SASI_Rn01_00039195 predicted 391
5 SASI_Rn01_00039196 predicted 360
6 SASI_Rn01_00039197 predicted 245
7 SASI_Rn01_00039198 predicted 272
8 SASI_Rn01_00039199 predicted 351
9 SASI_Rn01_00039200 predicted 398
10 SASI_Rn02_00269001 predicted 239
11 SASI_Rn01_00039201 predicted 383
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008936 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00108390 predicted 480
2 SASI_Mm01_00108391 predicted 383
3 SASI_Mm01_00108392 predicted 477
4 SASI_Mm01_00108393 predicted 418
5 SASI_Mm01_00108394 predicted 471
6 SASI_Mm01_00108395 predicted 469
7 SASI_Mm01_00108396 predicted 470
8 SASI_Mm02_00314974 predicted 374
9 SASI_Mm01_00108397 predicted 466
10 SASI_Mm02_00314975 predicted 570
11 SASI_Mm01_00108398 predicted 383
12 SASI_Mm01_00108399 predicted 574
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006261
PROP1 MISSION shRNA Bacterial Glycerol Stock
PROP paired-like homeobox 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435796    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006261.4-1289s21c1
Sequence:CCGGAGGTGAGGGCCTTCATTAATTCTCGAGAATTAATGAAGGCCCTCACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419006    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006261.4-1095s21c1
Sequence:CCGGTGAGGGTCAGCTCAGCGATTACTCGAGTAATCGCTGAGCTGACCCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006261.4-567s21c1
Sequence:CCGGAGCCTTTGGGAGGAACCAGTACTCGAGTACTGGTTCCTCCCAAAGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016163    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006261.2-1104s1c1
Sequence:CCGGGCTCACCGATTAGAAATTTAACTCGAGTTAAATTTCTAATCGGTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006261.2-666s1c1
Sequence:CCGGCCGCAGAGCTAAGCAACGGAACTCGAGTTCCGTTGCTTAGCTCTGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006261.2-966s1c1
Sequence:CCGGTGAGCCATCCAAGTCCTGGAACTCGAGTTCCAGGACTTGGATGGCTCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006261.2-769s1c1
Sequence:CCGGCCCTATTCTTACGCAGCACCACTCGAGTGGTGCTGCGTAAGAATAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006261.2-818s1c1
Sequence:CCGGCCTACAGCCATGCCCTCCCTTCTCGAGAAGGGAGGGCATGGCTGTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006261
PROP1 MISSION shRNA shRNA Plasmid DNA
PROP paired-like homeobox 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435796    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006261.4-1289s21c1
Sequence:CCGGAGGTGAGGGCCTTCATTAATTCTCGAGAATTAATGAAGGCCCTCACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419006    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006261.4-1095s21c1
Sequence:CCGGTGAGGGTCAGCTCAGCGATTACTCGAGTAATCGCTGAGCTGACCCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006261.4-567s21c1
Sequence:CCGGAGCCTTTGGGAGGAACCAGTACTCGAGTACTGGTTCCTCCCAAAGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016163    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006261.2-1104s1c1
Sequence:CCGGGCTCACCGATTAGAAATTTAACTCGAGTTAAATTTCTAATCGGTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006261.2-666s1c1
Sequence:CCGGCCGCAGAGCTAAGCAACGGAACTCGAGTTCCGTTGCTTAGCTCTGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006261.2-966s1c1
Sequence:CCGGTGAGCCATCCAAGTCCTGGAACTCGAGTTCCAGGACTTGGATGGCTCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006261.2-769s1c1
Sequence:CCGGCCCTATTCTTACGCAGCACCACTCGAGTGGTGCTGCGTAAGAATAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006261.2-818s1c1
Sequence:CCGGCCTACAGCCATGCCCTCCCTTCTCGAGAAGGGAGGGCATGGCTGTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006261
PROP1 MISSION shRNA Lentiviral Transduction Particles
PROP paired-like homeobox 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435796    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006261.4-1289s21c1
Sequence:CCGGAGGTGAGGGCCTTCATTAATTCTCGAGAATTAATGAAGGCCCTCACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419006    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006261.4-1095s21c1
Sequence:CCGGTGAGGGTCAGCTCAGCGATTACTCGAGTAATCGCTGAGCTGACCCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006261.4-567s21c1
Sequence:CCGGAGCCTTTGGGAGGAACCAGTACTCGAGTACTGGTTCCTCCCAAAGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016163    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006261.2-1104s1c1
Sequence:CCGGGCTCACCGATTAGAAATTTAACTCGAGTTAAATTTCTAATCGGTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006261.2-666s1c1
Sequence:CCGGCCGCAGAGCTAAGCAACGGAACTCGAGTTCCGTTGCTTAGCTCTGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006261.2-966s1c1
Sequence:CCGGTGAGCCATCCAAGTCCTGGAACTCGAGTTCCAGGACTTGGATGGCTCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006261.2-769s1c1
Sequence:CCGGCCCTATTCTTACGCAGCACCACTCGAGTGGTGCTGCGTAAGAATAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006261.2-818s1c1
Sequence:CCGGCCTACAGCCATGCCCTCCCTTCTCGAGAAGGGAGGGCATGGCTGTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008936
PROP1 MISSION shRNA Bacterial Glycerol Stock
PROP paired-like homeobox 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000419152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008936.1-723s21c1
Sequence:CCGGTCATCCCTACAGCCACTCTCTCTCGAGAGAGAGTGGCTGTAGGGATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008936.1-445s21c1
Sequence:CCGGTTCAACCCAGCACAGCTGGAACTCGAGTTCCAGCTGTGCTGGGTTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008936.1-262s21c1
Sequence:CCGGCAAACGAAGGGTCATGCCTGTCTCGAGACAGGCATGACCCTTCGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008936.1-604s1c1
Sequence:CCGGCGGTCACTTCTCCAGCCGATACTCGAGTATCGGCTGGAGAAGTGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008936.1-627s1c1
Sequence:CCGGCCATCTATCTACGGCCACCTTCTCGAGAAGGTGGCCGTAGATAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008936.1-592s1c1
Sequence:CCGGCGGAAGCAAGAGCGGTCACTTCTCGAGAAGTGACCGCTCTTGCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008936.1-670s1c1
Sequence:CCGGTCTGCCTATCCCTACACCTATCTCGAGATAGGTGTAGGGATAGGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008936.1-486s1c1
Sequence:CCGGGAGGAACCAGTATCCTGACATCTCGAGATGTCAGGATACTGGTTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008936
PROP1 MISSION shRNA shRNA Plasmid DNA
PROP paired-like homeobox 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000419152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008936.1-723s21c1
Sequence:CCGGTCATCCCTACAGCCACTCTCTCTCGAGAGAGAGTGGCTGTAGGGATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008936.1-445s21c1
Sequence:CCGGTTCAACCCAGCACAGCTGGAACTCGAGTTCCAGCTGTGCTGGGTTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008936.1-262s21c1
Sequence:CCGGCAAACGAAGGGTCATGCCTGTCTCGAGACAGGCATGACCCTTCGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008936.1-604s1c1
Sequence:CCGGCGGTCACTTCTCCAGCCGATACTCGAGTATCGGCTGGAGAAGTGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008936.1-627s1c1
Sequence:CCGGCCATCTATCTACGGCCACCTTCTCGAGAAGGTGGCCGTAGATAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008936.1-592s1c1
Sequence:CCGGCGGAAGCAAGAGCGGTCACTTCTCGAGAAGTGACCGCTCTTGCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008936.1-670s1c1
Sequence:CCGGTCTGCCTATCCCTACACCTATCTCGAGATAGGTGTAGGGATAGGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008936.1-486s1c1
Sequence:CCGGGAGGAACCAGTATCCTGACATCTCGAGATGTCAGGATACTGGTTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008936
PROP1 MISSION shRNA Lentiviral Transduction Particles
PROP paired-like homeobox 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000419152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008936.1-723s21c1
Sequence:CCGGTCATCCCTACAGCCACTCTCTCTCGAGAGAGAGTGGCTGTAGGGATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008936.1-445s21c1
Sequence:CCGGTTCAACCCAGCACAGCTGGAACTCGAGTTCCAGCTGTGCTGGGTTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008936.1-262s21c1
Sequence:CCGGCAAACGAAGGGTCATGCCTGTCTCGAGACAGGCATGACCCTTCGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008936.1-604s1c1
Sequence:CCGGCGGTCACTTCTCCAGCCGATACTCGAGTATCGGCTGGAGAAGTGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008936.1-627s1c1
Sequence:CCGGCCATCTATCTACGGCCACCTTCTCGAGAAGGTGGCCGTAGATAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008936.1-592s1c1
Sequence:CCGGCGGAAGCAAGAGCGGTCACTTCTCGAGAAGTGACCGCTCTTGCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008936.1-670s1c1
Sequence:CCGGTCTGCCTATCCCTACACCTATCTCGAGATAGGTGTAGGGATAGGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008936.1-486s1c1
Sequence:CCGGGAGGAACCAGTATCCTGACATCTCGAGATGTCAGGATACTGGTTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks