EMAIL THIS PAGE TO A FRIEND

PROSER2

proline and serine-rich protein 2

Synonyms: C10orf47
Gene ID:
Mouse(227545) proline and serine rich 2
Rat(683460) proline and serine-rich protein 2
dog(607757) proline and serine-rich protein 2
cow(781700) proline and serine-rich protein 2
naked mole-rat(101707245) proline and serine-rich protein 2
domestic guinea pig(100723283) proline and serine-rich protein 2
53 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153256 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153256 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153256 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_144883 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_144883 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_144883 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_153256 Rosetta Predictions human pricing
XM_001065347 Rosetta Predictions rat pricing
XM_001065403 Rosetta Predictions rat pricing
NM_144883 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153256 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00104323 predicted 462
2 SASI_Hs01_00104324 predicted 359
3 SASI_Hs01_00104326 predicted 1578
4 SASI_Hs01_00104327 predicted 1654
5 SASI_Hs01_00104328 predicted 308
6 SASI_Hs01_00104329 predicted 1654
7 SASI_Hs01_00104330 predicted 347
8 SASI_Hs02_00367122 predicted 733
9 SASI_Hs01_00104331 predicted 1493
10 SASI_Hs01_00104332 predicted 1504
11 SASI_Hs01_00104325 predicted 1658
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001065347 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00313823 predicted 558
2 SASI_Rn02_00313824 predicted 665
3 SASI_Rn02_00313825 predicted 1614
4 SASI_Rn02_00313826 predicted 1073
5 SASI_Rn02_00313827 predicted 280
6 SASI_Rn02_00313828 predicted 358
7 SASI_Rn02_00313829 predicted 641
8 SASI_Rn02_00313830 predicted 738
9 SASI_Rn02_00313831 predicted 1087
10 SASI_Rn02_00313832 predicted 378
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001065403 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00314004 predicted 554
2 SASI_Rn02_00314005 predicted 687
3 SASI_Rn02_00314006 predicted 1632
4 SASI_Rn02_00314007 predicted 1090
5 SASI_Rn02_00314008 predicted 281
6 SASI_Rn02_00314009 predicted 350
7 SASI_Rn02_00314010 predicted 758
8 SASI_Rn02_00314011 predicted 663
9 SASI_Rn02_00314012 predicted 1105
10 SASI_Rn02_00314013 predicted 383
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144883 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00113450 predicted 1019
2 SASI_Mm01_00113452 predicted 941
3 SASI_Mm01_00113453 predicted 605
4 SASI_Mm01_00113454 predicted 586
5 SASI_Mm01_00113455 predicted 380
6 SASI_Mm01_00113456 predicted 351
7 SASI_Mm01_00113457 predicted 422
8 SASI_Mm02_00340333 predicted 531
9 SASI_Mm01_00113458 predicted 1395
10 SASI_Mm01_00113459 predicted 1497
11 SASI_Mm01_00113451 predicted 1039
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153256
VALIDATED
PROSER2 MISSION shRNA Bacterial Glycerol Stock
proline and serine-rich protein 2
Human
17 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000446088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153256.3-474s21c1
Sequence:CCGGTCATCGACTTAGTGCAGCCAGCTCGAGCTGGCTGCACTAAGTCGATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414369    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153256.3-1796s21c1
Sequence:CCGGGGACTGGTCTGATTATCATTCCTCGAGGAATGATAATCAGACCAGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419227    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153256.3-271s21c1
Sequence:CCGGTCGCTCCAGAAGCTTCACTTTCTCGAGAAAGTGAAGCTTCTGGAGCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421012    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153256.3-1839s21c1
Sequence:CCGGTCGAAGTACATGACATGAAAGCTCGAGCTTTCATGTCATGTACTTCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153256.3-735s21c1
Sequence:CCGGCCCTCGTTATGGCGCAGAAGACTCGAGTCTTCTGCGCCATAACGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_153256.2-350s1c1
Sequence:CCGGGAAGAGACGATTGACTCCCTACTCGAGTAGGGAGTCAATCGTCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127577    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_153256.2-916s1c1
Sequence:CCGGCAGCAACATCATCGTCACCAACTCGAGTTGGTGACGATGATGTTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127576    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153256.2-288s1c1
Sequence:CCGGCTTTGGATGATGAGAGCCTGACTCGAGTCAGGCTCTCATCATCCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127575    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153256.2-186s1c1
Sequence:CCGGCTGACATGAACTCAGACACGTCTCGAGACGTGTCTGAGTTCATGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127853    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_153256.2-463s1c1
Sequence:CCGGGCCTGAAGATGTCATCGACTTCTCGAGAAGTCGATGACATCTTCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127919    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153256.2-286s1c1
Sequence:CCGGCACTTTGGATGATGAGAGCCTCTCGAGAGGCTCTCATCATCCAAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_153256.2-181s1c1
Sequence:CCGGCGCATCTGACATGAACTCAGACTCGAGTCTGAGTTCATGTCAGATGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153256.2-748s1c1
Sequence:CCGGGCAGAAGATTTCCGAGAGGATCTCGAGATCCTCTCGGAAATCTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128022    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_153256.2-568s1c1
Sequence:CCGGGCACAGGAAACAAGATGCTGACTCGAGTCAGCATCTTGTTTCCTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128596    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153256.2-2475s1c1
Sequence:CCGGGCAAGACTGTTCACTAAAGAACTCGAGTTCTTTAGTGAACAGTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130607    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153256.2-749s1c1
Sequence:CCGGCAGAAGATTTCCGAGAGGATGCTCGAGCATCCTCTCGGAAATCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130326    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_153256.2-282s1c1
Sequence:CCGGGCTTCACTTTGGATGATGAGACTCGAGTCTCATCATCCAAAGTGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153256
VALIDATED
PROSER2 MISSION shRNA shRNA Plasmid DNA
proline and serine-rich protein 2
Human
17 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000446088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153256.3-474s21c1
Sequence:CCGGTCATCGACTTAGTGCAGCCAGCTCGAGCTGGCTGCACTAAGTCGATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414369    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153256.3-1796s21c1
Sequence:CCGGGGACTGGTCTGATTATCATTCCTCGAGGAATGATAATCAGACCAGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419227    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153256.3-271s21c1
Sequence:CCGGTCGCTCCAGAAGCTTCACTTTCTCGAGAAAGTGAAGCTTCTGGAGCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421012    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153256.3-1839s21c1
Sequence:CCGGTCGAAGTACATGACATGAAAGCTCGAGCTTTCATGTCATGTACTTCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153256.3-735s21c1
Sequence:CCGGCCCTCGTTATGGCGCAGAAGACTCGAGTCTTCTGCGCCATAACGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_153256.2-350s1c1
Sequence:CCGGGAAGAGACGATTGACTCCCTACTCGAGTAGGGAGTCAATCGTCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127577    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_153256.2-916s1c1
Sequence:CCGGCAGCAACATCATCGTCACCAACTCGAGTTGGTGACGATGATGTTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127576    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153256.2-288s1c1
Sequence:CCGGCTTTGGATGATGAGAGCCTGACTCGAGTCAGGCTCTCATCATCCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127575    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153256.2-186s1c1
Sequence:CCGGCTGACATGAACTCAGACACGTCTCGAGACGTGTCTGAGTTCATGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127853    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_153256.2-463s1c1
Sequence:CCGGGCCTGAAGATGTCATCGACTTCTCGAGAAGTCGATGACATCTTCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127919    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153256.2-286s1c1
Sequence:CCGGCACTTTGGATGATGAGAGCCTCTCGAGAGGCTCTCATCATCCAAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_153256.2-181s1c1
Sequence:CCGGCGCATCTGACATGAACTCAGACTCGAGTCTGAGTTCATGTCAGATGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153256.2-748s1c1
Sequence:CCGGGCAGAAGATTTCCGAGAGGATCTCGAGATCCTCTCGGAAATCTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128022    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_153256.2-568s1c1
Sequence:CCGGGCACAGGAAACAAGATGCTGACTCGAGTCAGCATCTTGTTTCCTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128596    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153256.2-2475s1c1
Sequence:CCGGGCAAGACTGTTCACTAAAGAACTCGAGTTCTTTAGTGAACAGTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130607    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153256.2-749s1c1
Sequence:CCGGCAGAAGATTTCCGAGAGGATGCTCGAGCATCCTCTCGGAAATCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130326    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_153256.2-282s1c1
Sequence:CCGGGCTTCACTTTGGATGATGAGACTCGAGTCTCATCATCCAAAGTGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153256
VALIDATED
PROSER2 MISSION shRNA Lentiviral Transduction Particles
proline and serine-rich protein 2
Human
17 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000446088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153256.3-474s21c1
Sequence:CCGGTCATCGACTTAGTGCAGCCAGCTCGAGCTGGCTGCACTAAGTCGATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414369    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153256.3-1796s21c1
Sequence:CCGGGGACTGGTCTGATTATCATTCCTCGAGGAATGATAATCAGACCAGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419227    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153256.3-271s21c1
Sequence:CCGGTCGCTCCAGAAGCTTCACTTTCTCGAGAAAGTGAAGCTTCTGGAGCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421012    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153256.3-1839s21c1
Sequence:CCGGTCGAAGTACATGACATGAAAGCTCGAGCTTTCATGTCATGTACTTCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153256.3-735s21c1
Sequence:CCGGCCCTCGTTATGGCGCAGAAGACTCGAGTCTTCTGCGCCATAACGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_153256.2-350s1c1
Sequence:CCGGGAAGAGACGATTGACTCCCTACTCGAGTAGGGAGTCAATCGTCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127577    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_153256.2-916s1c1
Sequence:CCGGCAGCAACATCATCGTCACCAACTCGAGTTGGTGACGATGATGTTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127576    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153256.2-288s1c1
Sequence:CCGGCTTTGGATGATGAGAGCCTGACTCGAGTCAGGCTCTCATCATCCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127575    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153256.2-186s1c1
Sequence:CCGGCTGACATGAACTCAGACACGTCTCGAGACGTGTCTGAGTTCATGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127853    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_153256.2-463s1c1
Sequence:CCGGGCCTGAAGATGTCATCGACTTCTCGAGAAGTCGATGACATCTTCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127919    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153256.2-286s1c1
Sequence:CCGGCACTTTGGATGATGAGAGCCTCTCGAGAGGCTCTCATCATCCAAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_153256.2-181s1c1
Sequence:CCGGCGCATCTGACATGAACTCAGACTCGAGTCTGAGTTCATGTCAGATGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153256.2-748s1c1
Sequence:CCGGGCAGAAGATTTCCGAGAGGATCTCGAGATCCTCTCGGAAATCTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128022    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_153256.2-568s1c1
Sequence:CCGGGCACAGGAAACAAGATGCTGACTCGAGTCAGCATCTTGTTTCCTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128596    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153256.2-2475s1c1
Sequence:CCGGGCAAGACTGTTCACTAAAGAACTCGAGTTCTTTAGTGAACAGTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130607    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153256.2-749s1c1
Sequence:CCGGCAGAAGATTTCCGAGAGGATGCTCGAGCATCCTCTCGGAAATCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130326    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_153256.2-282s1c1
Sequence:CCGGGCTTCACTTTGGATGATGAGACTCGAGTCTCATCATCCAAAGTGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144883
PROSER2 MISSION shRNA Bacterial Glycerol Stock
proline and serine-rich protein 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000217123    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144883.3-3522s1c1
Sequence:CCGGCAGTACTTAAGGACCGTATTTCTCGAGAAATACGGTCCTTAAGTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217703    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144883.3-2233s1c1
Sequence:CCGGGTATCGTGAGTCTTCGTATACCTCGAGGTATACGAAGACTCACGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263429    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144883.3-352s21c1
Sequence:CCGGAGGACGTTATCCTGTTCTTTGCTCGAGCAAAGAACAGGATAACGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144883.3-378s21c1
Sequence:CCGGACTCTTGATTCCCTGGAATATCTCGAGATATTCCAGGGAATCAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263427    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144883.3-2423s21c1
Sequence:CCGGTATGCTCTGTTCCCAATTAAACTCGAGTTTAATTGGGAACAGAGCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144883.3-486s21c1
Sequence:CCGGCCCGAAGATGTCATCGATTTACTCGAGTAAATCGATGACATCTTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000282626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144883.3-294s21c1
Sequence:CCGGCGGTCCAGAAGTTTCACTATGCTCGAGCATAGTGAAACTTCTGGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184161    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144883.1-1129s1c1
Sequence:CCGGCAGCAACATAAGCGTGACCAACTCGAGTTGGTCACGCTTATGTTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179909    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144883.1-1159s1c1
Sequence:CCGGCAAGGACTTCAACAAGACCATCTCGAGATGGTCTTGTTGAAGTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144883
PROSER2 MISSION shRNA shRNA Plasmid DNA
proline and serine-rich protein 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000217123    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144883.3-3522s1c1
Sequence:CCGGCAGTACTTAAGGACCGTATTTCTCGAGAAATACGGTCCTTAAGTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217703    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144883.3-2233s1c1
Sequence:CCGGGTATCGTGAGTCTTCGTATACCTCGAGGTATACGAAGACTCACGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263429    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144883.3-352s21c1
Sequence:CCGGAGGACGTTATCCTGTTCTTTGCTCGAGCAAAGAACAGGATAACGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144883.3-378s21c1
Sequence:CCGGACTCTTGATTCCCTGGAATATCTCGAGATATTCCAGGGAATCAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263427    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144883.3-2423s21c1
Sequence:CCGGTATGCTCTGTTCCCAATTAAACTCGAGTTTAATTGGGAACAGAGCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144883.3-486s21c1
Sequence:CCGGCCCGAAGATGTCATCGATTTACTCGAGTAAATCGATGACATCTTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000282626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144883.3-294s21c1
Sequence:CCGGCGGTCCAGAAGTTTCACTATGCTCGAGCATAGTGAAACTTCTGGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184161    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144883.1-1129s1c1
Sequence:CCGGCAGCAACATAAGCGTGACCAACTCGAGTTGGTCACGCTTATGTTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179909    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144883.1-1159s1c1
Sequence:CCGGCAAGGACTTCAACAAGACCATCTCGAGATGGTCTTGTTGAAGTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144883
PROSER2 MISSION shRNA Lentiviral Transduction Particles
proline and serine-rich protein 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000217123    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144883.3-3522s1c1
Sequence:CCGGCAGTACTTAAGGACCGTATTTCTCGAGAAATACGGTCCTTAAGTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217703    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144883.3-2233s1c1
Sequence:CCGGGTATCGTGAGTCTTCGTATACCTCGAGGTATACGAAGACTCACGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263429    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144883.3-352s21c1
Sequence:CCGGAGGACGTTATCCTGTTCTTTGCTCGAGCAAAGAACAGGATAACGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144883.3-378s21c1
Sequence:CCGGACTCTTGATTCCCTGGAATATCTCGAGATATTCCAGGGAATCAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263427    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144883.3-2423s21c1
Sequence:CCGGTATGCTCTGTTCCCAATTAAACTCGAGTTTAATTGGGAACAGAGCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144883.3-486s21c1
Sequence:CCGGCCCGAAGATGTCATCGATTTACTCGAGTAAATCGATGACATCTTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000282626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144883.3-294s21c1
Sequence:CCGGCGGTCCAGAAGTTTCACTATGCTCGAGCATAGTGAAACTTCTGGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184161    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144883.1-1129s1c1
Sequence:CCGGCAGCAACATAAGCGTGACCAACTCGAGTTGGTCACGCTTATGTTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179909    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144883.1-1159s1c1
Sequence:CCGGCAAGGACTTCAACAAGACCATCTCGAGATGGTCTTGTTGAAGTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks