EMAIL THIS PAGE TO A FRIEND

PRPF8

pre-mRNA processing factor 8

Synonyms: HPRP8 PRP8 PRPC8 RP13 SNRNP220
UniProtKB ID: Q6P2Q9, O14547, O75965
Gene ID:
Human(10594) Summary: Pre-mRNA splicing occurs in 2 sequential transesterification steps. The protein encoded by this gene is a component of both U2- and U12-dependent spliceosomes, and found to be essential for the catalytic step II in pre-mRNA splicing process. It contains several WD repeats, which function in protein-protein interactions. This protein has a sequence similarity to yeast Prp8 protein. This gene is a candidate gene for autosomal dominant retinitis pigmentosa. [provided by RefSeq, Jul 2008]
Mouse(192159) pre-mRNA processing factor 8
Rat(287530) pre-mRNA processing factor 8
cow(507371) PRP8 pre-mRNA processing factor 8 homolog (S. cerevisiae)
sheep(101116489) PRP8 pre-mRNA processing factor 8 homolog (S. cerevisiae)
domestic guinea pig(100712742) pre-mRNA processing factor 8
naked mole-rat(101724713) pre-mRNA processing factor 8
Domestic Rabbit(100357344) PRP8 pre-mRNA processing factor 8 homolog (S. cerevisiae)
Zebrafish(393951) pre-mRNA processing factor 8
dog(480651) PRP8 pre-mRNA processing factor 8 homolog (S. cerevisiae)
chicken(417559) PRP8 pre-mRNA processing factor 8 homolog (S. cerevisiae)
Horse(100072388) PRP8 pre-mRNA processing factor 8 homolog (S. cerevisiae)
domestic cat(101100679) PRP8 pre-mRNA processing factor 8 homolog (S. cerevisiae)
61 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2700372 Anti-PRPF8 (C-terminal) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
western blot pricing
SAB2101885 Anti-PRPF8 antibody produced in rabbit affinity isolated antibody , horse, canine, mouse, bovine, rat, zebrafish, human, guinea pig, rabbit
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006445 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006445 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006445 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_138659 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_138659 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_138659 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006445 Rosetta Predictions human pricing
XM_001080695 Rosetta Predictions rat pricing
XM_213385 Rosetta Predictions rat pricing
NM_138659 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006445 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00015918 predicted 4000
2 SASI_Hs01_00015919 predicted 552
3 SASI_Hs02_00341582 predicted 3535
4 SASI_Hs01_00015920 predicted 5121
5 SASI_Hs02_00341583 predicted 1604
6 SASI_Hs01_00015922 predicted 4141
7 SASI_Hs01_00015923 predicted 4918
8 SASI_Hs01_00015924 predicted 3718
9 SASI_Hs01_00015925 predicted 5518
10 SASI_Hs01_00015926 predicted 1098
11 SASI_Hs01_00015917 predicted 6124
12 SASI_Hs01_00015921 predicted 588
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001080695 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00369000 predicted 4164
2 SASI_Rn02_00369001 predicted 1573
3 SASI_Rn02_00369002 predicted 6364
4 SASI_Rn02_00369003 predicted 557
5 SASI_Rn02_00369004 predicted 4657
6 SASI_Rn02_00369005 predicted 3145
7 SASI_Rn02_00369006 predicted 5082
8 SASI_Rn02_00369007 predicted 4632
9 SASI_Rn02_00369008 predicted 2342
10 SASI_Rn02_00369009 predicted 3110
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_213385 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00374569 predicted 336
2 SASI_Rn02_00374570 predicted 615
3 SASI_Rn02_00374571 predicted 472
4 SASI_Rn02_00374572 predicted 557
5 SASI_Rn02_00374573 predicted 521
6 SASI_Rn02_00374574 predicted 203
7 SASI_Rn02_00374575 predicted 302
8 SASI_Rn02_00374576 predicted 446
9 SASI_Rn02_00374577 predicted 544
10 SASI_Rn02_00374578 predicted 356
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138659 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00179411 predicted 5888
2 SASI_Mm02_00339716 predicted 4394
3 SASI_Mm01_00179412 predicted 6673
4 SASI_Mm01_00179413 predicted 715
5 SASI_Mm01_00179414 predicted 6711
6 SASI_Mm01_00179415 predicted 3322
7 SASI_Mm01_00179417 predicted 4864
8 SASI_Mm01_00179418 predicted 5321
9 SASI_Mm02_00339717 predicted 1002
10 SASI_Mm02_00339718 predicted 5624
11 SASI_Mm01_00179416 predicted 5969
12 SASI_Mm01_00179419 predicted 2145
13 SASI_Mm01_00179420 predicted 1203
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006445
VALIDATED
PRPF8 MISSION shRNA Bacterial Glycerol Stock
pre-mRNA processing factor 8
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000075108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006445.2-4134s1c1
Sequence:CCGGCCCAACTTGTACCGCTACATACTCGAGTATGTAGCGGTACAAGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006445.2-6906s1c1
Sequence:CCGGCCCAACATGAAATATGAGCTACTCGAGTAGCTCATATTTCATGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075111    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_006445.2-888s1c1
Sequence:CCGGCGAGACATCAACCTACAGGATCTCGAGATCCTGTAGGTTGATGTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_006445.2-3459s1c1
Sequence:CCGGCGCCTCATGAAACATGATGTTCTCGAGAACATCATGTTTCATGAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075109    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_006445.2-5253s1c1
Sequence:CCGGGCCCTGTATGTGTTACGTGAACTCGAGTTCACGTAACACATACAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290329    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_006445.3-5329s21c1
Sequence:CCGGGCCCTGTATGTGTTACGTGAACTCGAGTTCACGTAACACATACAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_006445.3-3535s21c1
Sequence:CCGGCGCCTCATGAAACATGATGTTCTCGAGAACATCATGTTTCATGAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290330    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_006445.3-964s21c1
Sequence:CCGGCGAGACATCAACCTACAGGATCTCGAGATCCTGTAGGTTGATGTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000307172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_006445.3-4210s21c1
Sequence:CCGGCCCAACTTGTACCGCTACATACTCGAGTATGTAGCGGTACAAGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006445
VALIDATED
PRPF8 MISSION shRNA shRNA Plasmid DNA
pre-mRNA processing factor 8
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000075108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006445.2-4134s1c1
Sequence:CCGGCCCAACTTGTACCGCTACATACTCGAGTATGTAGCGGTACAAGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006445.2-6906s1c1
Sequence:CCGGCCCAACATGAAATATGAGCTACTCGAGTAGCTCATATTTCATGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075111    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_006445.2-888s1c1
Sequence:CCGGCGAGACATCAACCTACAGGATCTCGAGATCCTGTAGGTTGATGTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_006445.2-3459s1c1
Sequence:CCGGCGCCTCATGAAACATGATGTTCTCGAGAACATCATGTTTCATGAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075109    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_006445.2-5253s1c1
Sequence:CCGGGCCCTGTATGTGTTACGTGAACTCGAGTTCACGTAACACATACAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290329    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_006445.3-5329s21c1
Sequence:CCGGGCCCTGTATGTGTTACGTGAACTCGAGTTCACGTAACACATACAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_006445.3-3535s21c1
Sequence:CCGGCGCCTCATGAAACATGATGTTCTCGAGAACATCATGTTTCATGAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290330    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_006445.3-964s21c1
Sequence:CCGGCGAGACATCAACCTACAGGATCTCGAGATCCTGTAGGTTGATGTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000307172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_006445.3-4210s21c1
Sequence:CCGGCCCAACTTGTACCGCTACATACTCGAGTATGTAGCGGTACAAGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006445
VALIDATED
PRPF8 MISSION shRNA Lentiviral Transduction Particles
pre-mRNA processing factor 8
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000075108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006445.2-4134s1c1
Sequence:CCGGCCCAACTTGTACCGCTACATACTCGAGTATGTAGCGGTACAAGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006445.2-6906s1c1
Sequence:CCGGCCCAACATGAAATATGAGCTACTCGAGTAGCTCATATTTCATGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075111    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_006445.2-888s1c1
Sequence:CCGGCGAGACATCAACCTACAGGATCTCGAGATCCTGTAGGTTGATGTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_006445.2-3459s1c1
Sequence:CCGGCGCCTCATGAAACATGATGTTCTCGAGAACATCATGTTTCATGAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075109    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_006445.2-5253s1c1
Sequence:CCGGGCCCTGTATGTGTTACGTGAACTCGAGTTCACGTAACACATACAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290329    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_006445.3-5329s21c1
Sequence:CCGGGCCCTGTATGTGTTACGTGAACTCGAGTTCACGTAACACATACAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_006445.3-3535s21c1
Sequence:CCGGCGCCTCATGAAACATGATGTTCTCGAGAACATCATGTTTCATGAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290330    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_006445.3-964s21c1
Sequence:CCGGCGAGACATCAACCTACAGGATCTCGAGATCCTGTAGGTTGATGTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000307172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_006445.3-4210s21c1
Sequence:CCGGCCCAACTTGTACCGCTACATACTCGAGTATGTAGCGGTACAAGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138659
VALIDATED
PRPF8 MISSION shRNA Bacterial Glycerol Stock
pre-mRNA processing factor 8
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000109108    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138659.1-4659s1c1
Sequence:CCGGCCAACCATCAATCGAGCCAATCTCGAGATTGGCTCGATTGATGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109106    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138659.1-6297s1c1
Sequence:CCGGCGGACCAATCATATTTATGTTCTCGAGAACATAAATATGATTGGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138659.1-1952s1c1
Sequence:CCGGGCTGTTCTTTATGCGTGGAATCTCGAGATTCCACGCATAAAGAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138659.1-576s1c1
Sequence:CCGGGCCGACAACATCTTAGATGTTCTCGAGAACATCTAAGATGTTGTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138659.1-3870s1c1
Sequence:CCGGGCTGTGGTGAATACACAGGAACTCGAGTTCCTGTGTATTCACCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138659.2-850s21c1
Sequence:CCGGGCCGACAACATCTTAGATGTTCTCGAGAACATCTAAGATGTTGTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138659.2-4144s21c1
Sequence:CCGGGCTGTGGTGAATACACAGGAACTCGAGTTCCTGTGTATTCACCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138659.2-6571s21c1
Sequence:CCGGCGGACCAATCATATTTATGTTCTCGAGAACATAAATATGATTGGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138659.2-4933s21c1
Sequence:CCGGCCAACCATCAATCGAGCCAATCTCGAGATTGGCTCGATTGATGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138659.2-2226s21c1
Sequence:CCGGGCTGTTCTTTATGCGTGGAATCTCGAGATTCCACGCATAAAGAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138659
VALIDATED
PRPF8 MISSION shRNA shRNA Plasmid DNA
pre-mRNA processing factor 8
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000109108    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138659.1-4659s1c1
Sequence:CCGGCCAACCATCAATCGAGCCAATCTCGAGATTGGCTCGATTGATGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109106    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138659.1-6297s1c1
Sequence:CCGGCGGACCAATCATATTTATGTTCTCGAGAACATAAATATGATTGGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138659.1-1952s1c1
Sequence:CCGGGCTGTTCTTTATGCGTGGAATCTCGAGATTCCACGCATAAAGAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138659.1-576s1c1
Sequence:CCGGGCCGACAACATCTTAGATGTTCTCGAGAACATCTAAGATGTTGTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138659.1-3870s1c1
Sequence:CCGGGCTGTGGTGAATACACAGGAACTCGAGTTCCTGTGTATTCACCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138659.2-850s21c1
Sequence:CCGGGCCGACAACATCTTAGATGTTCTCGAGAACATCTAAGATGTTGTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138659.2-4144s21c1
Sequence:CCGGGCTGTGGTGAATACACAGGAACTCGAGTTCCTGTGTATTCACCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138659.2-6571s21c1
Sequence:CCGGCGGACCAATCATATTTATGTTCTCGAGAACATAAATATGATTGGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138659.2-4933s21c1
Sequence:CCGGCCAACCATCAATCGAGCCAATCTCGAGATTGGCTCGATTGATGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138659.2-2226s21c1
Sequence:CCGGGCTGTTCTTTATGCGTGGAATCTCGAGATTCCACGCATAAAGAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138659
VALIDATED
PRPF8 MISSION shRNA Lentiviral Transduction Particles
pre-mRNA processing factor 8
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000109108    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138659.1-4659s1c1
Sequence:CCGGCCAACCATCAATCGAGCCAATCTCGAGATTGGCTCGATTGATGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109106    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138659.1-6297s1c1
Sequence:CCGGCGGACCAATCATATTTATGTTCTCGAGAACATAAATATGATTGGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138659.1-1952s1c1
Sequence:CCGGGCTGTTCTTTATGCGTGGAATCTCGAGATTCCACGCATAAAGAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138659.1-576s1c1
Sequence:CCGGGCCGACAACATCTTAGATGTTCTCGAGAACATCTAAGATGTTGTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138659.1-3870s1c1
Sequence:CCGGGCTGTGGTGAATACACAGGAACTCGAGTTCCTGTGTATTCACCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138659.2-850s21c1
Sequence:CCGGGCCGACAACATCTTAGATGTTCTCGAGAACATCTAAGATGTTGTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138659.2-4144s21c1
Sequence:CCGGGCTGTGGTGAATACACAGGAACTCGAGTTCCTGTGTATTCACCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138659.2-6571s21c1
Sequence:CCGGCGGACCAATCATATTTATGTTCTCGAGAACATAAATATGATTGGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138659.2-4933s21c1
Sequence:CCGGCCAACCATCAATCGAGCCAATCTCGAGATTGGCTCGATTGATGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138659.2-2226s21c1
Sequence:CCGGGCTGTTCTTTATGCGTGGAATCTCGAGATTCCACGCATAAAGAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks