EMAIL THIS PAGE TO A FRIEND

PRR13

proline rich 13

Synonyms: TXR1
UniProtKB ID: Q9NZ81, Q0V8U0, Q6FIG7, Q6MZP8, Q6NXQ6, Q6PKF9
Gene ID:
Mouse(66151) proline rich 13
Rat(363004) proline rich 13
domestic cat(101086158) proline rich 13
cow(506705) proline rich 13
sheep(101103886) proline rich 13
130 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025385 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025385 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025385 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018457 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018457 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018457 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001005354 Rosetta Predictions human pricing
NM_001005355 Rosetta Predictions human pricing
NM_018457 Rosetta Predictions human pricing
NM_001008379 Rosetta Predictions rat pricing
NM_025385 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005354 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00304862 predicted 508
2 SASI_Hs01_00134476 predicted 649
3 SASI_Hs02_00304863 predicted 641
4 SASI_Hs01_00134477 predicted 783
5 SASI_Hs01_00134478 predicted 655
6 SASI_Hs02_00304864 predicted 443
7 SASI_Hs02_00304865 predicted 474
8 SASI_Hs02_00304866 predicted 441
9 SASI_Hs01_00134480 predicted 643
10 SASI_Hs01_00134481 predicted 763
11 SASI_Hs01_00134479 predicted 653
12 SASI_Hs01_00134482 predicted 577
13 SASI_Hs01_00134483 predicted 387
14 SASI_Hs01_00134484 predicted 647
15 SASI_Hs01_00134485 predicted 754
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005355 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00209796 predicted 806
2 SASI_Hs01_00209797 predicted 812
3 SASI_Hs01_00209798 predicted 791
4 SASI_Hs01_00209799 predicted 804
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018457 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00352009 predicted 659
2 SASI_Hs01_00094694 predicted 799
3 SASI_Hs02_00352010 predicted 793
4 SASI_Hs01_00094695 predicted 940
5 SASI_Hs01_00094696 predicted 810
6 SASI_Hs02_00352011 predicted 593
7 SASI_Hs02_00352012 predicted 622
8 SASI_Hs02_00352013 predicted 594
9 SASI_Hs01_00094698 predicted 792
10 SASI_Hs01_00094699 predicted 912
11 SASI_Hs01_00094697 predicted 802
12 SASI_Hs01_00094700 predicted 734
13 SASI_Hs01_00094701 predicted 533
14 SASI_Hs01_00094702 predicted 796
15 SASI_Hs01_00094703 predicted 906
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008379 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00049456 predicted 237
2 SASI_Rn01_00049457 predicted 233
3 SASI_Rn01_00049458 predicted 198
4 SASI_Rn01_00049459 predicted 220
5 SASI_Rn01_00049460 predicted 201
6 SASI_Rn01_00049461 predicted 223
7 SASI_Rn01_00049462 predicted 217
8 SASI_Rn01_00049463 predicted 225
9 SASI_Rn01_00049464 predicted 225
10 SASI_Rn01_00049465 predicted 668
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025385 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00053132 predicted 839
2 SASI_Mm01_00053133 predicted 650
3 SASI_Mm01_00053134 predicted 840
4 SASI_Mm01_00053135 predicted 695
5 SASI_Mm01_00053137 predicted 826
6 SASI_Mm01_00053138 predicted 653
7 SASI_Mm01_00053139 predicted 834
8 SASI_Mm01_00053140 predicted 839
9 SASI_Mm01_00053141 predicted 653
10 SASI_Mm01_00053136 predicted 826
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025385
PRR13 MISSION shRNA Bacterial Glycerol Stock
proline rich 13
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000438592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025385.3-387s21c1
Sequence:CCGGCCTTATCCTGTACCACAACCACTCGAGTGGTTGTGGTACAGGATAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436402    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025385.3-969s21c1
Sequence:CCGGGACTTGGGTTTGTGACAGTTTCTCGAGAAACTGTCACAAACCCAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438602    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025385.3-511s21c1
Sequence:CCGGCCGGAATCGTGATAGACAAGACTCGAGTCTTGTCTATCACGATTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198978    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025385.2-709s1c1
Sequence:CCGGGAAGTCGCACAAGCATCACAACTCGAGTTGTGATGCTTGTGCGACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198089    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025385.2-1166s1c1
Sequence:CCGGCGGCACATGAGAGTGATTTAACTCGAGTTAAATCACTCTCATGTGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025385.2-697s1c1
Sequence:CCGGGAAAGCTCATAAGAAGTCGCACTCGAGTGCGACTTCTTATGAGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198453    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025385.2-1105s1c1
Sequence:CCGGGTAACACTTGTGACTTGGGTTCTCGAGAACCCAAGTCACAAGTGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025385.2-701s1c1
Sequence:CCGGGCTCATAAGAAGTCGCACAAGCTCGAGCTTGTGCGACTTCTTATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025385.2-704s1c1
Sequence:CCGGCATAAGAAGTCGCACAAGCATCTCGAGATGCTTGTGCGACTTCTTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025385
PRR13 MISSION shRNA shRNA Plasmid DNA
proline rich 13
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000438592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025385.3-387s21c1
Sequence:CCGGCCTTATCCTGTACCACAACCACTCGAGTGGTTGTGGTACAGGATAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436402    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025385.3-969s21c1
Sequence:CCGGGACTTGGGTTTGTGACAGTTTCTCGAGAAACTGTCACAAACCCAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438602    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025385.3-511s21c1
Sequence:CCGGCCGGAATCGTGATAGACAAGACTCGAGTCTTGTCTATCACGATTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198978    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025385.2-709s1c1
Sequence:CCGGGAAGTCGCACAAGCATCACAACTCGAGTTGTGATGCTTGTGCGACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198089    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025385.2-1166s1c1
Sequence:CCGGCGGCACATGAGAGTGATTTAACTCGAGTTAAATCACTCTCATGTGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025385.2-697s1c1
Sequence:CCGGGAAAGCTCATAAGAAGTCGCACTCGAGTGCGACTTCTTATGAGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198453    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025385.2-1105s1c1
Sequence:CCGGGTAACACTTGTGACTTGGGTTCTCGAGAACCCAAGTCACAAGTGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025385.2-701s1c1
Sequence:CCGGGCTCATAAGAAGTCGCACAAGCTCGAGCTTGTGCGACTTCTTATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025385.2-704s1c1
Sequence:CCGGCATAAGAAGTCGCACAAGCATCTCGAGATGCTTGTGCGACTTCTTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025385
PRR13 MISSION shRNA Lentiviral Transduction Particles
proline rich 13
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000438592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025385.3-387s21c1
Sequence:CCGGCCTTATCCTGTACCACAACCACTCGAGTGGTTGTGGTACAGGATAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436402    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025385.3-969s21c1
Sequence:CCGGGACTTGGGTTTGTGACAGTTTCTCGAGAAACTGTCACAAACCCAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438602    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025385.3-511s21c1
Sequence:CCGGCCGGAATCGTGATAGACAAGACTCGAGTCTTGTCTATCACGATTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198978    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025385.2-709s1c1
Sequence:CCGGGAAGTCGCACAAGCATCACAACTCGAGTTGTGATGCTTGTGCGACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198089    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025385.2-1166s1c1
Sequence:CCGGCGGCACATGAGAGTGATTTAACTCGAGTTAAATCACTCTCATGTGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025385.2-697s1c1
Sequence:CCGGGAAAGCTCATAAGAAGTCGCACTCGAGTGCGACTTCTTATGAGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198453    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025385.2-1105s1c1
Sequence:CCGGGTAACACTTGTGACTTGGGTTCTCGAGAACCCAAGTCACAAGTGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025385.2-701s1c1
Sequence:CCGGGCTCATAAGAAGTCGCACAAGCTCGAGCTTGTGCGACTTCTTATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025385.2-704s1c1
Sequence:CCGGCATAAGAAGTCGCACAAGCATCTCGAGATGCTTGTGCGACTTCTTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018457
VALIDATED
PRR13 MISSION shRNA Bacterial Glycerol Stock
proline rich 13
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000250138    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_018457.3-457s21c1
Sequence:CCGGTGGTTGGACCAGCAGTGATAGCTCGAGCTATCACTGCTGGTCCAACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250137    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_018457.3-242s21c1
Sequence:CCGGTGCCCACCCACCACCTATTAACTCGAGTTAATAGGTGGTGGGTGGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 2 Clone ID:NM_018457.3-541s21c1
Sequence:CCGGACCACAAGTACCACAAGCATGCTCGAGCATGCTTGTGGTACTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250135    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_018457.3-812s21c1
Sequence:CCGGTGGTTAGATCATATAGCTAATCTCGAGATTAGCTATATGATCTAACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_018457.3-594s21c1
Sequence:CCGGAGCAGTGATTCTGACTGAATACTCGAGTATTCAGTCAGAATCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172658    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018457.2-446s1c1
Sequence:CCGGGTTGGACCAGCAGTGATAGTACTCGAGTACTATCACTGCTGGTCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018457
VALIDATED
PRR13 MISSION shRNA shRNA Plasmid DNA
proline rich 13
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000250138    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_018457.3-457s21c1
Sequence:CCGGTGGTTGGACCAGCAGTGATAGCTCGAGCTATCACTGCTGGTCCAACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250137    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_018457.3-242s21c1
Sequence:CCGGTGCCCACCCACCACCTATTAACTCGAGTTAATAGGTGGTGGGTGGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 2 Clone ID:NM_018457.3-541s21c1
Sequence:CCGGACCACAAGTACCACAAGCATGCTCGAGCATGCTTGTGGTACTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250135    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_018457.3-812s21c1
Sequence:CCGGTGGTTAGATCATATAGCTAATCTCGAGATTAGCTATATGATCTAACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_018457.3-594s21c1
Sequence:CCGGAGCAGTGATTCTGACTGAATACTCGAGTATTCAGTCAGAATCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172658    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018457.2-446s1c1
Sequence:CCGGGTTGGACCAGCAGTGATAGTACTCGAGTACTATCACTGCTGGTCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018457
VALIDATED
PRR13 MISSION shRNA Lentiviral Transduction Particles
proline rich 13
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000250138    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_018457.3-457s21c1
Sequence:CCGGTGGTTGGACCAGCAGTGATAGCTCGAGCTATCACTGCTGGTCCAACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250137    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_018457.3-242s21c1
Sequence:CCGGTGCCCACCCACCACCTATTAACTCGAGTTAATAGGTGGTGGGTGGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 2 Clone ID:NM_018457.3-541s21c1
Sequence:CCGGACCACAAGTACCACAAGCATGCTCGAGCATGCTTGTGGTACTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250135    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_018457.3-812s21c1
Sequence:CCGGTGGTTAGATCATATAGCTAATCTCGAGATTAGCTATATGATCTAACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_018457.3-594s21c1
Sequence:CCGGAGCAGTGATTCTGACTGAATACTCGAGTATTCAGTCAGAATCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172658    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018457.2-446s1c1
Sequence:CCGGGTTGGACCAGCAGTGATAGTACTCGAGTACTATCACTGCTGGTCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks