EMAIL THIS PAGE TO A FRIEND

PRR16

proline rich 16

Synonyms: DSC54
UniProtKB ID: Q569H4, D3DSZ0, Q8IXY1, Q9NYI5
Gene ID:
Mouse(71373) proline rich 16
Rat(361327) proline rich 16
Zebrafish(793445) proline rich 16
chicken(769337) proline rich 16
cow(615789) proline rich 16
naked mole-rat(101712649) proline rich 16
103 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016644 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016644 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016644 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081224 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081224 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081224 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016644 Rosetta Predictions human pricing
NM_001108432 Rosetta Predictions rat pricing
NM_001081224 Rosetta Predictions mouse pricing
XM_484730 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016644 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00064310 predicted 701
2 SASI_Hs01_00064311 predicted 789
3 SASI_Hs01_00064312 predicted 799
4 SASI_Hs01_00064313 predicted 730
5 SASI_Hs01_00064314 predicted 1529
6 SASI_Hs01_00064315 predicted 1538
7 SASI_Hs01_00064316 predicted 890
8 SASI_Hs01_00064318 predicted 1469
9 SASI_Hs01_00064319 predicted 830
10 SASI_Hs02_00349813 predicted 1523
11 SASI_Hs01_00064317 predicted 838
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108432 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00238579 predicted 758
2 SASI_Rn02_00238580 predicted 295
3 SASI_Rn02_00238581 predicted 468
4 SASI_Rn02_00238582 predicted 460
5 SASI_Rn02_00238583 predicted 874
6 SASI_Rn02_00238584 predicted 1584
7 SASI_Rn02_00238585 predicted 703
8 SASI_Rn02_00238586 predicted 530
9 SASI_Rn02_00238587 predicted 1011
10 SASI_Rn02_00238588 predicted 839
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081224 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00296401 predicted 1323
2 SASI_Mm02_00296402 predicted 1303
3 SASI_Mm02_00296403 predicted 1062
4 SASI_Mm02_00296404 predicted 584
5 SASI_Mm02_00296405 predicted 937
6 SASI_Mm02_00296406 predicted 213
7 SASI_Mm02_00296407 predicted 1217
8 SASI_Mm02_00296408 predicted 938
9 SASI_Mm02_00296409 predicted 695
10 SASI_Mm02_00296410 predicted 1317
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_484730 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00243138 predicted 1234
2 SASI_Mm01_00243139 predicted 1255
3 SASI_Mm01_00243140 predicted 752
4 SASI_Mm01_00243141 predicted 1112
5 SASI_Mm01_00243142 predicted 382
6 SASI_Mm01_00243143 predicted 1388
7 SASI_Mm01_00243144 predicted 1109
8 SASI_Mm01_00243145 predicted 863
9 SASI_Mm01_00243146 predicted 878
10 SASI_Mm01_00243147 predicted 464
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016644
VALIDATED
PRR16 MISSION shRNA Bacterial Glycerol Stock
proline rich 16
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000123217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016644.1-744s1c1
Sequence:CCGGCCTTCTACGAAATGGAGGCTTCTCGAGAAGCCTCCATTTCGTAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016644.1-745s1c1
Sequence:CCGGCTTCTACGAAATGGAGGCTTACTCGAGTAAGCCTCCATTTCGTAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123215    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016644.1-892s1c1
Sequence:CCGGCGAGAACGAGTTCGGTTTAATCTCGAGATTAAACCGAACTCGTTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016644.1-942s1c1
Sequence:CCGGTGACTGTGATACCCGGTATAACTCGAGTTATACCGGGTATCACAGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123214    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016644.1-1338s1c1
Sequence:CCGGCCTGGTAAGTATGCAGCACATCTCGAGATGTGCTGCATACTTACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271317    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016644.1-1471s21c1
Sequence:CCGGACCTGCAGATTTCACCTATTTCTCGAGAAATAGGTGAAATCTGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271253    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016644.1-582s21c1
Sequence:CCGGGGCTAATGCACCGCTTATTAACTCGAGTTAATAAGCGGTGCATTAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271251    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016644.1-1195s21c1
Sequence:CCGGACCGTGTGATGTATGCCATTACTCGAGTAATGGCATACATCACACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016644.1-711s21c1
Sequence:CCGGTCCAACTGCCAATCCTGTAAACTCGAGTTTACAGGATTGGCAGTTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016644.1-802s21c1
Sequence:CCGGTGCTGCATACCCAACAGTAACCTCGAGGTTACTGTTGGGTATGCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016644
VALIDATED
PRR16 MISSION shRNA shRNA Plasmid DNA
proline rich 16
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000123217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016644.1-744s1c1
Sequence:CCGGCCTTCTACGAAATGGAGGCTTCTCGAGAAGCCTCCATTTCGTAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016644.1-745s1c1
Sequence:CCGGCTTCTACGAAATGGAGGCTTACTCGAGTAAGCCTCCATTTCGTAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123215    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016644.1-892s1c1
Sequence:CCGGCGAGAACGAGTTCGGTTTAATCTCGAGATTAAACCGAACTCGTTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016644.1-942s1c1
Sequence:CCGGTGACTGTGATACCCGGTATAACTCGAGTTATACCGGGTATCACAGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123214    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016644.1-1338s1c1
Sequence:CCGGCCTGGTAAGTATGCAGCACATCTCGAGATGTGCTGCATACTTACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271317    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016644.1-1471s21c1
Sequence:CCGGACCTGCAGATTTCACCTATTTCTCGAGAAATAGGTGAAATCTGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271253    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016644.1-582s21c1
Sequence:CCGGGGCTAATGCACCGCTTATTAACTCGAGTTAATAAGCGGTGCATTAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271251    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016644.1-1195s21c1
Sequence:CCGGACCGTGTGATGTATGCCATTACTCGAGTAATGGCATACATCACACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016644.1-711s21c1
Sequence:CCGGTCCAACTGCCAATCCTGTAAACTCGAGTTTACAGGATTGGCAGTTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016644.1-802s21c1
Sequence:CCGGTGCTGCATACCCAACAGTAACCTCGAGGTTACTGTTGGGTATGCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016644
VALIDATED
PRR16 MISSION shRNA Lentiviral Transduction Particles
proline rich 16
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000123217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016644.1-744s1c1
Sequence:CCGGCCTTCTACGAAATGGAGGCTTCTCGAGAAGCCTCCATTTCGTAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016644.1-745s1c1
Sequence:CCGGCTTCTACGAAATGGAGGCTTACTCGAGTAAGCCTCCATTTCGTAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123215    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016644.1-892s1c1
Sequence:CCGGCGAGAACGAGTTCGGTTTAATCTCGAGATTAAACCGAACTCGTTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016644.1-942s1c1
Sequence:CCGGTGACTGTGATACCCGGTATAACTCGAGTTATACCGGGTATCACAGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123214    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016644.1-1338s1c1
Sequence:CCGGCCTGGTAAGTATGCAGCACATCTCGAGATGTGCTGCATACTTACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271317    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016644.1-1471s21c1
Sequence:CCGGACCTGCAGATTTCACCTATTTCTCGAGAAATAGGTGAAATCTGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271253    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016644.1-582s21c1
Sequence:CCGGGGCTAATGCACCGCTTATTAACTCGAGTTAATAAGCGGTGCATTAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271251    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016644.1-1195s21c1
Sequence:CCGGACCGTGTGATGTATGCCATTACTCGAGTAATGGCATACATCACACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016644.1-711s21c1
Sequence:CCGGTCCAACTGCCAATCCTGTAAACTCGAGTTTACAGGATTGGCAGTTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016644.1-802s21c1
Sequence:CCGGTGCTGCATACCCAACAGTAACCTCGAGGTTACTGTTGGGTATGCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081224
VALIDATED
PRR16 MISSION shRNA Bacterial Glycerol Stock
proline rich 16
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000254511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081224.2-932s21c1
Sequence:CCGGCCACTACCACAGTGTGATATCCTCGAGGATATCACACTGTGGTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081224.2-637s21c1
Sequence:CCGGCGGGAACGAGTTCGGTTTAATCTCGAGATTAAACCGAACTCGTTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254510    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081224.2-113s21c1
Sequence:CCGGAGGAGCAGATCAAGATCATAGCTCGAGCTATGATCTTGATCTGCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254509    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081224.2-1584s21c1
Sequence:CCGGCTAATGTTCCTGAGGATTAAACTCGAGTTTAATCCTCAGGAACATTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081224.2-692s21c1
Sequence:CCGGGTGAGAGCCGGTATAACATAACTCGAGTTATGTTATACCGGCTCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081224
VALIDATED
PRR16 MISSION shRNA shRNA Plasmid DNA
proline rich 16
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000254511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081224.2-932s21c1
Sequence:CCGGCCACTACCACAGTGTGATATCCTCGAGGATATCACACTGTGGTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081224.2-637s21c1
Sequence:CCGGCGGGAACGAGTTCGGTTTAATCTCGAGATTAAACCGAACTCGTTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254510    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081224.2-113s21c1
Sequence:CCGGAGGAGCAGATCAAGATCATAGCTCGAGCTATGATCTTGATCTGCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254509    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081224.2-1584s21c1
Sequence:CCGGCTAATGTTCCTGAGGATTAAACTCGAGTTTAATCCTCAGGAACATTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081224.2-692s21c1
Sequence:CCGGGTGAGAGCCGGTATAACATAACTCGAGTTATGTTATACCGGCTCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081224
VALIDATED
PRR16 MISSION shRNA Lentiviral Transduction Particles
proline rich 16
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000254511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081224.2-932s21c1
Sequence:CCGGCCACTACCACAGTGTGATATCCTCGAGGATATCACACTGTGGTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081224.2-637s21c1
Sequence:CCGGCGGGAACGAGTTCGGTTTAATCTCGAGATTAAACCGAACTCGTTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254510    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081224.2-113s21c1
Sequence:CCGGAGGAGCAGATCAAGATCATAGCTCGAGCTATGATCTTGATCTGCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254509    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081224.2-1584s21c1
Sequence:CCGGCTAATGTTCCTGAGGATTAAACTCGAGTTTAATCCTCAGGAACATTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081224.2-692s21c1
Sequence:CCGGGTGAGAGCCGGTATAACATAACTCGAGTTATGTTATACCGGCTCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks