EMAIL THIS PAGE TO A FRIEND

PRR20C

proline rich 20C

Species: Human PRR20C(729240)
UniProtKB ID: P86479, Q8N7V5
Gene ID:
12 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001130405 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001130405 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001130405 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001132957 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001132957 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00390027 predicted 1274
2 SASI_Hs02_00390028 predicted 1088
3 SASI_Hs02_00390029 predicted 1013
4 SASI_Hs02_00390030 predicted 1272
5 SASI_Hs02_00390031 predicted 1077
6 SASI_Hs02_00390032 predicted 771
7 SASI_Hs02_00390033 predicted 1089
8 SASI_Hs02_00390034 predicted 865
9 SASI_Hs02_00390035 predicted 1099
10 SASI_Hs02_00390036 predicted 1155
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001130405
PRR20C MISSION shRNA Bacterial Glycerol Stock
proline rich 20C
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000269824    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001130405.1-878s21c1
Sequence:CCGGCCTCACCGACATTGCGTATTGCTCGAGCAATACGCAATGTCGGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269760    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001130405.1-386s21c1
Sequence:CCGGCATCGCTTACGTGAAACCCTTCTCGAGAAGGGTTTCACGTAAGCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001130405.1-639s21c1
Sequence:CCGGTTCTCCCTTTCTGAAACAGGTCTCGAGACCTGTTTCAGAAAGGGAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269763    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001130405.1-1164s21c1
Sequence:CCGGGATGCAACAAGGATCACTAAGCTCGAGCTTAGTGATCCTTGTTGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001130405.1-780s21c1
Sequence:CCGGCTCTATCCCTGCATCGGGTTTCTCGAGAAACCCGATGCAGGGATAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001130405
PRR20C MISSION shRNA shRNA Plasmid DNA
proline rich 20C
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000269824    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001130405.1-878s21c1
Sequence:CCGGCCTCACCGACATTGCGTATTGCTCGAGCAATACGCAATGTCGGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269760    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001130405.1-386s21c1
Sequence:CCGGCATCGCTTACGTGAAACCCTTCTCGAGAAGGGTTTCACGTAAGCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001130405.1-639s21c1
Sequence:CCGGTTCTCCCTTTCTGAAACAGGTCTCGAGACCTGTTTCAGAAAGGGAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269763    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001130405.1-1164s21c1
Sequence:CCGGGATGCAACAAGGATCACTAAGCTCGAGCTTAGTGATCCTTGTTGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001130405.1-780s21c1
Sequence:CCGGCTCTATCCCTGCATCGGGTTTCTCGAGAAACCCGATGCAGGGATAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001130405
PRR20C MISSION shRNA Lentiviral Transduction Particles
proline rich 20C
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000269824    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001130405.1-878s21c1
Sequence:CCGGCCTCACCGACATTGCGTATTGCTCGAGCAATACGCAATGTCGGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269760    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001130405.1-386s21c1
Sequence:CCGGCATCGCTTACGTGAAACCCTTCTCGAGAAGGGTTTCACGTAAGCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001130405.1-639s21c1
Sequence:CCGGTTCTCCCTTTCTGAAACAGGTCTCGAGACCTGTTTCAGAAAGGGAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269763    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001130405.1-1164s21c1
Sequence:CCGGGATGCAACAAGGATCACTAAGCTCGAGCTTAGTGATCCTTGTTGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001130405.1-780s21c1
Sequence:CCGGCTCTATCCCTGCATCGGGTTTCTCGAGAAACCCGATGCAGGGATAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks