EMAIL THIS PAGE TO A FRIEND

PRR23A

proline rich 23A

UniProtKB ID: A6NEV1
Gene ID:
Mouse(623166) proline rich 23A
dog(611131) proline rich 23A
domestic cat(101091647) proline rich 23A
cow(616710) proline rich 23A
cow(616673) proline rich 23A
sheep(101110477) proline rich 23A
naked mole-rat(101728982) proline rich 23A
37 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001134660 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001134660 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001134660 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001134659 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001134659 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001134659 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001725401 Rosetta Predictions human pricing
XM_001473725 Rosetta Predictions mouse pricing
XM_887600 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001725401 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00467516 predicted 406
2 SASI_Hs02_00467517 predicted 532
3 SASI_Hs02_00467518 predicted 476
4 SASI_Hs02_00467519 predicted 483
5 SASI_Hs02_00467520 predicted 533
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001473725 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00370248 predicted 821
2 SASI_Mm02_00370249 predicted 543
3 SASI_Mm02_00370250 predicted 595
4 SASI_Mm02_00370251 predicted 541
5 SASI_Mm02_00370252 predicted 226
6 SASI_Mm02_00370253 predicted 818
7 SASI_Mm02_00370254 predicted 821
8 SASI_Mm02_00370255 predicted 974
9 SASI_Mm02_00370256 predicted 970
10 SASI_Mm02_00370257 predicted 967
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_887600 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00428491 predicted 824
2 SASI_Mm01_00270284 predicted 589
3 SASI_Mm02_00428492 predicted 820
4 SASI_Mm02_00428493 predicted 823
5 SASI_Mm02_00428494 predicted 971
6 SASI_Mm02_00428495 predicted 979
7 SASI_Mm02_00428496 predicted 975
8 SASI_Mm02_00428497 predicted 956
9 SASI_Mm02_00428498 predicted 846
10 SASI_Mm02_00428499 predicted 902
11 SASI_Mm01_00270281 predicted 426
12 SASI_Mm01_00270282 predicted 444
13 SASI_Mm01_00270283 predicted 423
14 SASI_Mm01_00270285 predicted 600
15 SASI_Mm01_00270286 predicted 601
16 SASI_Mm01_00270287 predicted 47
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001134660
PRR23A MISSION shRNA Bacterial Glycerol Stock
proline rich 23A
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000284470    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001134660.1-886s21c1
Sequence:CCGGGTGGGCAGAATGTAGAATATTCTCGAGAATATTCTACATTCTGCCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000270923    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001134660.1-785s21c1
Sequence:CCGGTGCACAAATCCTCGATGCCTCCTCGAGGAGGCATCGAGGATTTGTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000270924    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001134660.1-829s21c1
Sequence:CCGGTGCCATTGTGTGCCTTTACAGCTCGAGCTGTAAAGGCACACAATGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000270852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001134660.1-596s21c1
Sequence:CCGGAGCGATATTCTCCTAGGTTTACTCGAGTAAACCTAGGAGAATATCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000270850    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001134660.1-854s21c1
Sequence:CCGGTACAAGGTTAGGATAACATTCCTCGAGGAATGTTATCCTAACCTTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001134660
PRR23A MISSION shRNA shRNA Plasmid DNA
proline rich 23A
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000284470    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001134660.1-886s21c1
Sequence:CCGGGTGGGCAGAATGTAGAATATTCTCGAGAATATTCTACATTCTGCCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000270923    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001134660.1-785s21c1
Sequence:CCGGTGCACAAATCCTCGATGCCTCCTCGAGGAGGCATCGAGGATTTGTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000270924    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001134660.1-829s21c1
Sequence:CCGGTGCCATTGTGTGCCTTTACAGCTCGAGCTGTAAAGGCACACAATGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000270852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001134660.1-596s21c1
Sequence:CCGGAGCGATATTCTCCTAGGTTTACTCGAGTAAACCTAGGAGAATATCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000270850    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001134660.1-854s21c1
Sequence:CCGGTACAAGGTTAGGATAACATTCCTCGAGGAATGTTATCCTAACCTTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001134660
PRR23A MISSION shRNA Lentiviral Transduction Particles
proline rich 23A
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000284470    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001134660.1-886s21c1
Sequence:CCGGGTGGGCAGAATGTAGAATATTCTCGAGAATATTCTACATTCTGCCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000270923    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001134660.1-785s21c1
Sequence:CCGGTGCACAAATCCTCGATGCCTCCTCGAGGAGGCATCGAGGATTTGTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000270924    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001134660.1-829s21c1
Sequence:CCGGTGCCATTGTGTGCCTTTACAGCTCGAGCTGTAAAGGCACACAATGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000270852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001134660.1-596s21c1
Sequence:CCGGAGCGATATTCTCCTAGGTTTACTCGAGTAAACCTAGGAGAATATCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000270850    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001134660.1-854s21c1
Sequence:CCGGTACAAGGTTAGGATAACATTCCTCGAGGAATGTTATCCTAACCTTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001134659
PRR23A MISSION shRNA Bacterial Glycerol Stock
proline rich 23A
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000262600    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001134659.1-2043s21c1
Sequence:CCGGCTGAATTGGCAGTCGTTATTTCTCGAGAAATAACGACTGCCAATTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262602    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001134659.1-407s21c1
Sequence:CCGGTCGTTGAGCAGGAAGTCTTCTCTCGAGAGAAGACTTCCTGCTCAACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262604    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001134659.1-418s21c1
Sequence:CCGGGAAGTCTTCTGCGCATCTGTCCTCGAGGACAGATGCGCAGAAGACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001134659.1-798s21c1
Sequence:CCGGATGAACTGCTTCCCACAATCCCTCGAGGGATTGTGGGAAGCAGTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001134659.1-785s21c1
Sequence:CCGGGACTGTTCCAGGAATGAACTGCTCGAGCAGTTCATTCCTGGAACAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001134659
PRR23A MISSION shRNA shRNA Plasmid DNA
proline rich 23A
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000262600    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001134659.1-2043s21c1
Sequence:CCGGCTGAATTGGCAGTCGTTATTTCTCGAGAAATAACGACTGCCAATTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262602    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001134659.1-407s21c1
Sequence:CCGGTCGTTGAGCAGGAAGTCTTCTCTCGAGAGAAGACTTCCTGCTCAACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262604    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001134659.1-418s21c1
Sequence:CCGGGAAGTCTTCTGCGCATCTGTCCTCGAGGACAGATGCGCAGAAGACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001134659.1-798s21c1
Sequence:CCGGATGAACTGCTTCCCACAATCCCTCGAGGGATTGTGGGAAGCAGTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001134659.1-785s21c1
Sequence:CCGGGACTGTTCCAGGAATGAACTGCTCGAGCAGTTCATTCCTGGAACAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001134659
PRR23A MISSION shRNA Lentiviral Transduction Particles
proline rich 23A
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000262600    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001134659.1-2043s21c1
Sequence:CCGGCTGAATTGGCAGTCGTTATTTCTCGAGAAATAACGACTGCCAATTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262602    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001134659.1-407s21c1
Sequence:CCGGTCGTTGAGCAGGAAGTCTTCTCTCGAGAGAAGACTTCCTGCTCAACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262604    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001134659.1-418s21c1
Sequence:CCGGGAAGTCTTCTGCGCATCTGTCCTCGAGGACAGATGCGCAGAAGACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001134659.1-798s21c1
Sequence:CCGGATGAACTGCTTCCCACAATCCCTCGAGGGATTGTGGGAAGCAGTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001134659.1-785s21c1
Sequence:CCGGGACTGTTCCAGGAATGAACTGCTCGAGCAGTTCATTCCTGGAACAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks