EMAIL THIS PAGE TO A FRIEND

PRR5-ARHGAP8

PRR5-ARHGAP8 readthrough

Gene ID:
Human(553158) Summary: The PRR5-ARHGAP8 mRNA is an infrequent but naturally occurring read-through transcript of the neighboring proline rich 5, renal (PRR5) and Rho GTPase activating protein 8 (ARHGAP8) genes. The resulting fusion protein contains sequence identity with each individual gene product, and it includes domains characteristic of a RhoGAP protein. The significance of this read-through transcript and the function of its protein product have not yet been determined. [provided by RefSeq, Nov 2010]
54 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_181334 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_181334 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_181334 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_181334 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181334 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00369992 predicted 1369
2 SASI_Hs01_00175246 predicted 841
3 SASI_Hs01_00175247 predicted 1282
4 SASI_Hs01_00175248 predicted 976
5 SASI_Hs01_00175249 predicted 1049
6 SASI_Hs01_00175250 predicted 1006
7 SASI_Hs01_00175251 predicted 1360
8 SASI_Hs01_00175252 predicted 843
9 SASI_Hs01_00175253 predicted 994
10 SASI_Hs01_00175254 predicted 832
11 SASI_Hs01_00175255 predicted 1164
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181334
PRR5-ARHGAP8 MISSION shRNA Bacterial Glycerol Stock
PRR5-ARHGAP8 readthrough
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000123099    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181334.3-1573s1c1
Sequence:CCGGCACTCTGTATATTTCGAGCTACTCGAGTAGCTCGAAATATACAGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181334.3-1564s1c1
Sequence:CCGGTGTTGCGAACACTCTGTATATCTCGAGATATACAGAGTGTTCGCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181334.3-1249s1c1
Sequence:CCGGCGGGAGAGCATCTTCAACAAACTCGAGTTTGTTGAAGATGCTCTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181334.3-536s1c1
Sequence:CCGGGCGCATACAAGGAGTTCGATACTCGAGTATCGAACTCCTTGTATGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181334.3-465s1c1
Sequence:CCGGCGATTATACCATCGTCTATTTCTCGAGAAATAGACGATGGTATAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181334
PRR5-ARHGAP8 MISSION shRNA shRNA Plasmid DNA
PRR5-ARHGAP8 readthrough
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000123099    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181334.3-1573s1c1
Sequence:CCGGCACTCTGTATATTTCGAGCTACTCGAGTAGCTCGAAATATACAGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181334.3-1564s1c1
Sequence:CCGGTGTTGCGAACACTCTGTATATCTCGAGATATACAGAGTGTTCGCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181334.3-1249s1c1
Sequence:CCGGCGGGAGAGCATCTTCAACAAACTCGAGTTTGTTGAAGATGCTCTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181334.3-536s1c1
Sequence:CCGGGCGCATACAAGGAGTTCGATACTCGAGTATCGAACTCCTTGTATGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181334.3-465s1c1
Sequence:CCGGCGATTATACCATCGTCTATTTCTCGAGAAATAGACGATGGTATAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181334
PRR5-ARHGAP8 MISSION shRNA Lentiviral Transduction Particles
PRR5-ARHGAP8 readthrough
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000123099    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181334.3-1573s1c1
Sequence:CCGGCACTCTGTATATTTCGAGCTACTCGAGTAGCTCGAAATATACAGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181334.3-1564s1c1
Sequence:CCGGTGTTGCGAACACTCTGTATATCTCGAGATATACAGAGTGTTCGCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181334.3-1249s1c1
Sequence:CCGGCGGGAGAGCATCTTCAACAAACTCGAGTTTGTTGAAGATGCTCTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181334.3-536s1c1
Sequence:CCGGGCGCATACAAGGAGTTCGATACTCGAGTATCGAACTCCTTGTATGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181334.3-465s1c1
Sequence:CCGGCGATTATACCATCGTCTATTTCTCGAGAAATAGACGATGGTATAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks