EMAIL THIS PAGE TO A FRIEND

PRRG2

proline rich Gla (G-carboxyglutamic acid) 2

Synonyms: PRGP2
UniProtKB ID: O14669, Q6IBF8
Gene ID:
Mouse(65116) proline-rich Gla (G-carboxyglutamic acid) polypeptide 2
Rat(361570) proline rich Gla (G-carboxyglutamic acid) 2
domestic guinea pig(100725720) proline rich Gla (G-carboxyglutamic acid) 2
naked mole-rat(101725254) proline rich Gla (G-carboxyglutamic acid) 2
cow(511235) proline rich Gla (G-carboxyglutamic acid) 2
sheep(101107127) proline rich Gla (G-carboxyglutamic acid) 2
Zebrafish(100005937) proline rich Gla (G-carboxyglutamic acid) 2
dog(611918) proline rich Gla (G-carboxyglutamic acid) 2
domestic cat(101096431) proline rich Gla (G-carboxyglutamic acid) 2
75 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000951 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000951 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000951 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_022999 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_022999 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_022999 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU153341 MISSION® esiRNA esiRNA human PRRG2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000951 Rosetta Predictions human pricing
NM_001108482 Rosetta Predictions rat pricing
NM_022999 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000951 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00193943 predicted 770
2 SASI_Hs01_00193945 predicted 768
3 SASI_Hs01_00193946 predicted 769
4 SASI_Hs01_00193947 predicted 776
5 SASI_Hs01_00193948 predicted 259
6 SASI_Hs01_00193949 predicted 765
7 SASI_Hs01_00193950 predicted 761
8 SASI_Hs01_00193951 predicted 926
9 SASI_Hs02_00303564 predicted 934
10 SASI_Hs01_00193952 predicted 841
11 SASI_Hs01_00193944 predicted 783
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108482 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00239079 predicted 453
2 SASI_Rn02_00239080 predicted 544
3 SASI_Rn02_00239081 predicted 377
4 SASI_Rn02_00239082 predicted 373
5 SASI_Rn02_00239083 predicted 428
6 SASI_Rn02_00239084 predicted 458
7 SASI_Rn02_00239085 predicted 555
8 SASI_Rn02_00239086 predicted 444
9 SASI_Rn02_00239087 predicted 247
10 SASI_Rn02_00239088 predicted 546
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022999 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00035956 predicted 478
2 SASI_Mm01_00035957 predicted 403
3 SASI_Mm01_00035958 predicted 640
4 SASI_Mm01_00035959 predicted 613
5 SASI_Mm01_00035960 predicted 702
6 SASI_Mm01_00035961 predicted 369
7 SASI_Mm01_00035962 predicted 397
8 SASI_Mm01_00035963 predicted 367
9 SASI_Mm01_00035964 predicted 408
10 SASI_Mm02_00326729 predicted 704
11 SASI_Mm01_00035955 predicted 315
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000951
PRRG2 MISSION shRNA Bacterial Glycerol Stock
proline rich Gla (G-carboxyglutamic acid) 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432301    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000951.2-816s21c1
Sequence:CCGGATTCATACCGGATTCCGGAAGCTCGAGCTTCCGGAATCCGGTATGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420224    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000951.2-238s21c1
Sequence:CCGGGAGACAGACCAAGAAGTCTTCCTCGAGGAAGACTTCTTGGTCTGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419136    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000951.2-1097s21c1
Sequence:CCGGATCTTGTGTATGGGCAGATATCTCGAGATATCTGCCCATACACAAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000951.1-60s1c1
Sequence:CCGGCCTGGATACTTCACCCAGTGACTCGAGTCACTGGGTGAAGTATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000951.1-449s1c1
Sequence:CCGGCCGGGCTCATTAGCCCTCTGACTCGAGTCAGAGGGCTAATGAGCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000951.1-286s1c1
Sequence:CCGGAGCTACATCTACAATGGCAAACTCGAGTTTGCCATTGTAGATGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000951.1-206s1c1
Sequence:CCGGAGTGTCTGGAAGAGAGGTGTTCTCGAGAACACCTCTCTTCCAGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000951.1-352s1c1
Sequence:CCGGACAGGTGGCATCCTGCTCATTCTCGAGAATGAGCAGGATGCCACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000951
PRRG2 MISSION shRNA shRNA Plasmid DNA
proline rich Gla (G-carboxyglutamic acid) 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432301    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000951.2-816s21c1
Sequence:CCGGATTCATACCGGATTCCGGAAGCTCGAGCTTCCGGAATCCGGTATGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420224    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000951.2-238s21c1
Sequence:CCGGGAGACAGACCAAGAAGTCTTCCTCGAGGAAGACTTCTTGGTCTGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419136    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000951.2-1097s21c1
Sequence:CCGGATCTTGTGTATGGGCAGATATCTCGAGATATCTGCCCATACACAAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000951.1-60s1c1
Sequence:CCGGCCTGGATACTTCACCCAGTGACTCGAGTCACTGGGTGAAGTATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000951.1-449s1c1
Sequence:CCGGCCGGGCTCATTAGCCCTCTGACTCGAGTCAGAGGGCTAATGAGCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000951.1-286s1c1
Sequence:CCGGAGCTACATCTACAATGGCAAACTCGAGTTTGCCATTGTAGATGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000951.1-206s1c1
Sequence:CCGGAGTGTCTGGAAGAGAGGTGTTCTCGAGAACACCTCTCTTCCAGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000951.1-352s1c1
Sequence:CCGGACAGGTGGCATCCTGCTCATTCTCGAGAATGAGCAGGATGCCACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000951
PRRG2 MISSION shRNA Lentiviral Transduction Particles
proline rich Gla (G-carboxyglutamic acid) 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432301    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000951.2-816s21c1
Sequence:CCGGATTCATACCGGATTCCGGAAGCTCGAGCTTCCGGAATCCGGTATGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420224    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000951.2-238s21c1
Sequence:CCGGGAGACAGACCAAGAAGTCTTCCTCGAGGAAGACTTCTTGGTCTGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419136    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000951.2-1097s21c1
Sequence:CCGGATCTTGTGTATGGGCAGATATCTCGAGATATCTGCCCATACACAAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000951.1-60s1c1
Sequence:CCGGCCTGGATACTTCACCCAGTGACTCGAGTCACTGGGTGAAGTATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000951.1-449s1c1
Sequence:CCGGCCGGGCTCATTAGCCCTCTGACTCGAGTCAGAGGGCTAATGAGCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000951.1-286s1c1
Sequence:CCGGAGCTACATCTACAATGGCAAACTCGAGTTTGCCATTGTAGATGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000951.1-206s1c1
Sequence:CCGGAGTGTCTGGAAGAGAGGTGTTCTCGAGAACACCTCTCTTCCAGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000951.1-352s1c1
Sequence:CCGGACAGGTGGCATCCTGCTCATTCTCGAGAATGAGCAGGATGCCACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022999
PRRG2 MISSION shRNA Bacterial Glycerol Stock
proline rich Gla (G-carboxyglutamic acid) 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000104784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022999.1-408s1c1
Sequence:CCGGCTGGGAAAGCTATACGTACAACTCGAGTTGTACGTATAGCTTTCCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022999.1-405s1c1
Sequence:CCGGCTTCTGGGAAAGCTATACGTACTCGAGTACGTATAGCTTTCCCAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022999.1-244s1c1
Sequence:CCGGGAGGCCCAGAGTTTCTTAGTTCTCGAGAACTAAGAAACTCTGGGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022999.1-646s1c1
Sequence:CCGGCCCACCTATGAGCAGGCTTTACTCGAGTAAAGCCTGCTCATAGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104780    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022999.1-1127s1c1
Sequence:CCGGGCGGTTTGTAATCCAGTATAACTCGAGTTATACTGGATTACAAACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022999
PRRG2 MISSION shRNA shRNA Plasmid DNA
proline rich Gla (G-carboxyglutamic acid) 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000104784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022999.1-408s1c1
Sequence:CCGGCTGGGAAAGCTATACGTACAACTCGAGTTGTACGTATAGCTTTCCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022999.1-405s1c1
Sequence:CCGGCTTCTGGGAAAGCTATACGTACTCGAGTACGTATAGCTTTCCCAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022999.1-244s1c1
Sequence:CCGGGAGGCCCAGAGTTTCTTAGTTCTCGAGAACTAAGAAACTCTGGGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022999.1-646s1c1
Sequence:CCGGCCCACCTATGAGCAGGCTTTACTCGAGTAAAGCCTGCTCATAGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104780    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022999.1-1127s1c1
Sequence:CCGGGCGGTTTGTAATCCAGTATAACTCGAGTTATACTGGATTACAAACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022999
PRRG2 MISSION shRNA Lentiviral Transduction Particles
proline rich Gla (G-carboxyglutamic acid) 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000104784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022999.1-408s1c1
Sequence:CCGGCTGGGAAAGCTATACGTACAACTCGAGTTGTACGTATAGCTTTCCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022999.1-405s1c1
Sequence:CCGGCTTCTGGGAAAGCTATACGTACTCGAGTACGTATAGCTTTCCCAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022999.1-244s1c1
Sequence:CCGGGAGGCCCAGAGTTTCTTAGTTCTCGAGAACTAAGAAACTCTGGGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022999.1-646s1c1
Sequence:CCGGCCCACCTATGAGCAGGCTTTACTCGAGTAAAGCCTGCTCATAGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104780    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022999.1-1127s1c1
Sequence:CCGGGCGGTTTGTAATCCAGTATAACTCGAGTTATACTGGATTACAAACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks