EMAIL THIS PAGE TO A FRIEND

PRSS38

protease, serine, 38

Synonyms: MPN2
UniProtKB ID: A1L453, Q7RTY6
Gene ID:
Mouse(216797) protease, serine, 38
Rat(287358) protease, serine, 38
domestic cat(101081112) protease, serine, 38
dog(475179) serine protease 44-like
naked mole-rat(101700684) protease, serine, 38
domestic guinea pig(100726147) protease, serine, 38
cow(618656) protease, serine, 38
sheep(101102562) protease, serine, 38
64 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_183062 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_183062 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_183062 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_137602 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_137602 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_137602 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_183062 Rosetta Predictions human pricing
XM_001077024 Rosetta Predictions rat pricing
XM_220559 Rosetta Predictions rat pricing
NM_001045521 Rosetta Predictions mouse pricing
XM_906084 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183062 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00216883 predicted 739
2 SASI_Hs01_00216884 predicted 830
3 SASI_Hs01_00216885 predicted 949
4 SASI_Hs01_00216886 predicted 331
5 SASI_Hs01_00216887 predicted 811
6 SASI_Hs01_00216888 predicted 534
7 SASI_Hs01_00216889 predicted 462
8 SASI_Hs01_00216890 predicted 599
9 SASI_Hs01_00216891 predicted 661
10 SASI_Hs01_00216892 predicted 369
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001077024 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00355479 predicted 947
2 SASI_Rn02_00355480 predicted 685
3 SASI_Rn02_00355481 predicted 1010
4 SASI_Rn02_00355482 predicted 1233
5 SASI_Rn02_00355483 predicted 1127
6 SASI_Rn02_00355484 predicted 734
7 SASI_Rn02_00355485 predicted 898
8 SASI_Rn02_00355486 predicted 533
9 SASI_Rn02_00355487 predicted 664
10 SASI_Rn02_00355488 predicted 938
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_220559 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00379401 predicted 951
2 SASI_Rn02_00379402 predicted 681
3 SASI_Rn02_00379403 predicted 1009
4 SASI_Rn02_00379404 predicted 1225
5 SASI_Rn02_00379405 predicted 1128
6 SASI_Rn02_00379406 predicted 736
7 SASI_Rn02_00379407 predicted 894
8 SASI_Rn02_00379408 predicted 541
9 SASI_Rn02_00379409 predicted 664
10 SASI_Rn02_00379410 predicted 936
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001045521 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00291564 predicted 532
2 SASI_Mm02_00291565 predicted 375
3 SASI_Mm02_00291566 predicted 872
4 SASI_Mm02_00291567 predicted 194
5 SASI_Mm02_00291568 predicted 649
6 SASI_Mm02_00291569 predicted 526
7 SASI_Mm02_00291570 predicted 866
8 SASI_Mm02_00291571 predicted 237
9 SASI_Mm02_00291572 predicted 623
10 SASI_Mm02_00291573 predicted 496
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_906084 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00269014 predicted 488
2 SASI_Mm01_00269015 predicted 625
3 SASI_Mm01_00269016 predicted 428
4 SASI_Mm01_00269017 predicted 396
5 SASI_Mm01_00269018 predicted 673
6 SASI_Mm01_00269019 predicted 1167
7 SASI_Mm01_00269020 predicted 532
8 SASI_Mm01_00269021 predicted 918
9 SASI_Mm01_00269022 predicted 731
10 SASI_Mm01_00269023 predicted 1133
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_183062
PRSS38 MISSION shRNA Bacterial Glycerol Stock
protease, serine, 38
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000424765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183062.2-704s21c1
Sequence:CCGGTGAATGCTAAGACCGTGTGTGCTCGAGCACACACGGTCTTAGCATTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183062.2-654s1c1
Sequence:CCGGCGGACACATGTCCTACATCATCTCGAGATGATGTAGGACATGTGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183062.2-300s1c1
Sequence:CCGGCTGCTTTCACAGGGACAAGAACTCGAGTTCTTGTCCCTGTGAAAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183062.2-824s1c1
Sequence:CCGGCTGGAGTGTATGCCAGTGTTTCTCGAGAAACACTGGCATACACTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183062.2-514s1c1
Sequence:CCGGGCAACTCCAGAAGTGAACCTTCTCGAGAAGGTTCACTTCTGGAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183062.2-741s1c1
Sequence:CCGGCCCACTTGTCTGTGAATTCAACTCGAGTTGAATTCACAGACAAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_183062
PRSS38 MISSION shRNA shRNA Plasmid DNA
protease, serine, 38
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000424765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183062.2-704s21c1
Sequence:CCGGTGAATGCTAAGACCGTGTGTGCTCGAGCACACACGGTCTTAGCATTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183062.2-654s1c1
Sequence:CCGGCGGACACATGTCCTACATCATCTCGAGATGATGTAGGACATGTGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183062.2-300s1c1
Sequence:CCGGCTGCTTTCACAGGGACAAGAACTCGAGTTCTTGTCCCTGTGAAAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183062.2-824s1c1
Sequence:CCGGCTGGAGTGTATGCCAGTGTTTCTCGAGAAACACTGGCATACACTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183062.2-514s1c1
Sequence:CCGGGCAACTCCAGAAGTGAACCTTCTCGAGAAGGTTCACTTCTGGAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183062.2-741s1c1
Sequence:CCGGCCCACTTGTCTGTGAATTCAACTCGAGTTGAATTCACAGACAAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_183062
PRSS38 MISSION shRNA Lentiviral Transduction Particles
protease, serine, 38
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000424765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183062.2-704s21c1
Sequence:CCGGTGAATGCTAAGACCGTGTGTGCTCGAGCACACACGGTCTTAGCATTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183062.2-654s1c1
Sequence:CCGGCGGACACATGTCCTACATCATCTCGAGATGATGTAGGACATGTGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183062.2-300s1c1
Sequence:CCGGCTGCTTTCACAGGGACAAGAACTCGAGTTCTTGTCCCTGTGAAAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183062.2-824s1c1
Sequence:CCGGCTGGAGTGTATGCCAGTGTTTCTCGAGAAACACTGGCATACACTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183062.2-514s1c1
Sequence:CCGGGCAACTCCAGAAGTGAACCTTCTCGAGAAGGTTCACTTCTGGAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183062.2-741s1c1
Sequence:CCGGCCCACTTGTCTGTGAATTCAACTCGAGTTGAATTCACAGACAAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_137602
PRSS38 MISSION shRNA Bacterial Glycerol Stock
protease, serine, 38
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000092123    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_137602.4-1277s1c1
Sequence:CCGGGCCCTGTTTCTATCCTCTCTACTCGAGTAGAGAGGATAGAAACAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_137602.4-60s1c1
Sequence:CCGGCCATCCCTTTGACTTCGACAACTCGAGTTGTCGAAGTCAAAGGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_137602.4-1125s1c1
Sequence:CCGGCCGTTATCACTTACAAATCATCTCGAGATGATTTGTAAGTGATAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_137602.4-909s1c1
Sequence:CCGGGCTCTATGGATTAAGCTCCTACTCGAGTAGGAGCTTAATCCATAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_137602.4-579s1c1
Sequence:CCGGGAAACTCGAAACCTATGATATCTCGAGATATCATAGGTTTCGAGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_137602
PRSS38 MISSION shRNA shRNA Plasmid DNA
protease, serine, 38
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000092123    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_137602.4-1277s1c1
Sequence:CCGGGCCCTGTTTCTATCCTCTCTACTCGAGTAGAGAGGATAGAAACAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_137602.4-60s1c1
Sequence:CCGGCCATCCCTTTGACTTCGACAACTCGAGTTGTCGAAGTCAAAGGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_137602.4-1125s1c1
Sequence:CCGGCCGTTATCACTTACAAATCATCTCGAGATGATTTGTAAGTGATAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_137602.4-909s1c1
Sequence:CCGGGCTCTATGGATTAAGCTCCTACTCGAGTAGGAGCTTAATCCATAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_137602.4-579s1c1
Sequence:CCGGGAAACTCGAAACCTATGATATCTCGAGATATCATAGGTTTCGAGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_137602
PRSS38 MISSION shRNA Lentiviral Transduction Particles
protease, serine, 38
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000092123    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_137602.4-1277s1c1
Sequence:CCGGGCCCTGTTTCTATCCTCTCTACTCGAGTAGAGAGGATAGAAACAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_137602.4-60s1c1
Sequence:CCGGCCATCCCTTTGACTTCGACAACTCGAGTTGTCGAAGTCAAAGGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_137602.4-1125s1c1
Sequence:CCGGCCGTTATCACTTACAAATCATCTCGAGATGATTTGTAAGTGATAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_137602.4-909s1c1
Sequence:CCGGGCTCTATGGATTAAGCTCCTACTCGAGTAGGAGCTTAATCCATAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_137602.4-579s1c1
Sequence:CCGGGAAACTCGAAACCTATGATATCTCGAGATATCATAGGTTTCGAGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks