EMAIL THIS PAGE TO A FRIEND

PRSS42

protease, serine, 42

Synonyms: TESSP2
UniProtKB ID: Q7Z5A4
Gene ID:
Mouse(235628) protease, serine, 42
Rat(301027) protease, serine, 42
domestic cat(101095722) protease, serine, 42
dog(609264) serine protease 42-like
naked mole-rat(101727786) protease, serine, 42
cow(504538) protease, serine, 42
sheep(101115659) protease, serine, 42
46 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_182702 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_182702 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_182702 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_153099 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153099 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153099 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU018841 MISSION® esiRNA esiRNA targeting mouse Tessp2 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_182702 Rosetta Predictions human pricing
NM_001106863 Rosetta Predictions rat pricing
NM_153099 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182702 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00101997 predicted 504
2 SASI_Hs01_00101998 predicted 393
3 SASI_Hs01_00101999 predicted 353
4 SASI_Hs01_00102000 predicted 431
5 SASI_Hs01_00102001 predicted 392
6 SASI_Hs01_00102002 predicted 459
7 SASI_Hs01_00102004 predicted 389
8 SASI_Hs02_00370866 predicted 544
9 SASI_Hs02_00370867 predicted 284
10 SASI_Hs01_00102006 predicted 452
11 SASI_Hs01_00102003 predicted 472
12 SASI_Hs01_00102005 predicted 426
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106863 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00223146 predicted 683
2 SASI_Rn02_00223147 predicted 597
3 SASI_Rn02_00223148 predicted 644
4 SASI_Rn02_00223149 predicted 690
5 SASI_Rn02_00223150 predicted 677
6 SASI_Rn02_00223151 predicted 355
7 SASI_Rn02_00223152 predicted 632
8 SASI_Rn02_00223153 predicted 627
9 SASI_Rn02_00223154 predicted 885
10 SASI_Rn02_00223155 predicted 540
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153099 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00174180 predicted 732
2 SASI_Mm02_00342949 predicted 530
3 SASI_Mm01_00174181 predicted 430
4 SASI_Mm01_00174182 predicted 1035
5 SASI_Mm01_00174183 predicted 953
6 SASI_Mm01_00174184 predicted 358
7 SASI_Mm01_00174185 predicted 930
8 SASI_Mm01_00174186 predicted 685
9 SASI_Mm01_00174187 predicted 924
10 SASI_Mm01_00174188 predicted 474
11 SASI_Mm01_00174189 predicted 721
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182702
PRSS42 MISSION shRNA Bacterial Glycerol Stock
protease, serine, 42
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000074063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182702.1-513s1c1
Sequence:CCGGGCTCCAACATCCTGTGAATTTCTCGAGAAATTCACAGGATGTTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182702.1-512s1c1
Sequence:CCGGAGCTCCAACATCCTGTGAATTCTCGAGAATTCACAGGATGTTGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182702.1-461s1c1
Sequence:CCGGACCCTAAGTTCTCAACAGTTACTCGAGTAACTGTTGAGAACTTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182702.1-460s1c1
Sequence:CCGGCACCCTAAGTTCTCAACAGTTCTCGAGAACTGTTGAGAACTTAGGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182702.1-372s1c1
Sequence:CCGGCCGTTTCCATTACAGTGTCAACTCGAGTTGACACTGTAATGGAAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182702.1-748s21c1
Sequence:CCGGGGGATGGTCTGTGGCTATAAACTCGAGTTTATAGCCACAGACCATCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430182    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182702.1-807s21c1
Sequence:CCGGCCGCTTGGCCTGTGAATATAACTCGAGTTATATTCACAGGCCAAGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418877    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182702.1-633s21c1
Sequence:CCGGAGAGAAACTTGCATCAGAAATCTCGAGATTTCTGATGCAAGTTTCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182702.1-722s21c1
Sequence:CCGGCATCTACTAAGGATGTAATAACTCGAGTTATTACATCCTTAGTAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428387    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182702.1-398s21c1
Sequence:CCGGGAGATCGGAGTGTCTATAATGCTCGAGCATTATAGACACTCCGATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182702
PRSS42 MISSION shRNA shRNA Plasmid DNA
protease, serine, 42
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000074063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182702.1-513s1c1
Sequence:CCGGGCTCCAACATCCTGTGAATTTCTCGAGAAATTCACAGGATGTTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182702.1-512s1c1
Sequence:CCGGAGCTCCAACATCCTGTGAATTCTCGAGAATTCACAGGATGTTGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182702.1-461s1c1
Sequence:CCGGACCCTAAGTTCTCAACAGTTACTCGAGTAACTGTTGAGAACTTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182702.1-460s1c1
Sequence:CCGGCACCCTAAGTTCTCAACAGTTCTCGAGAACTGTTGAGAACTTAGGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182702.1-372s1c1
Sequence:CCGGCCGTTTCCATTACAGTGTCAACTCGAGTTGACACTGTAATGGAAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182702.1-748s21c1
Sequence:CCGGGGGATGGTCTGTGGCTATAAACTCGAGTTTATAGCCACAGACCATCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430182    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182702.1-807s21c1
Sequence:CCGGCCGCTTGGCCTGTGAATATAACTCGAGTTATATTCACAGGCCAAGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418877    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182702.1-633s21c1
Sequence:CCGGAGAGAAACTTGCATCAGAAATCTCGAGATTTCTGATGCAAGTTTCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182702.1-722s21c1
Sequence:CCGGCATCTACTAAGGATGTAATAACTCGAGTTATTACATCCTTAGTAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428387    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182702.1-398s21c1
Sequence:CCGGGAGATCGGAGTGTCTATAATGCTCGAGCATTATAGACACTCCGATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182702
PRSS42 MISSION shRNA Lentiviral Transduction Particles
protease, serine, 42
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000074063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182702.1-513s1c1
Sequence:CCGGGCTCCAACATCCTGTGAATTTCTCGAGAAATTCACAGGATGTTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182702.1-512s1c1
Sequence:CCGGAGCTCCAACATCCTGTGAATTCTCGAGAATTCACAGGATGTTGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182702.1-461s1c1
Sequence:CCGGACCCTAAGTTCTCAACAGTTACTCGAGTAACTGTTGAGAACTTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182702.1-460s1c1
Sequence:CCGGCACCCTAAGTTCTCAACAGTTCTCGAGAACTGTTGAGAACTTAGGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182702.1-372s1c1
Sequence:CCGGCCGTTTCCATTACAGTGTCAACTCGAGTTGACACTGTAATGGAAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182702.1-748s21c1
Sequence:CCGGGGGATGGTCTGTGGCTATAAACTCGAGTTTATAGCCACAGACCATCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430182    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182702.1-807s21c1
Sequence:CCGGCCGCTTGGCCTGTGAATATAACTCGAGTTATATTCACAGGCCAAGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418877    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182702.1-633s21c1
Sequence:CCGGAGAGAAACTTGCATCAGAAATCTCGAGATTTCTGATGCAAGTTTCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182702.1-722s21c1
Sequence:CCGGCATCTACTAAGGATGTAATAACTCGAGTTATTACATCCTTAGTAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428387    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182702.1-398s21c1
Sequence:CCGGGAGATCGGAGTGTCTATAATGCTCGAGCATTATAGACACTCCGATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153099
PRSS42 MISSION shRNA Bacterial Glycerol Stock
protease, serine, 42
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000032629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153099.1-532s1c1
Sequence:CCGGCCCTGTGAATTTCACCACTAACTCGAGTTAGTGGTGAAATTCACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153099.1-472s1c1
Sequence:CCGGCCCTAAGTTCTCAACAACTATCTCGAGATAGTTGTTGAGAACTTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153099.1-367s1c1
Sequence:CCGGCCATTGTATTTACAGCCGAATCTCGAGATTCGGCTGTAAATACAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153099.1-771s1c1
Sequence:CCGGGTGGCTATAAAGAAAGAGGAACTCGAGTTCCTCTTTCTTTATAGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153099.1-196s1c1
Sequence:CCGGCCGCTCTCCTTTCATGAACTTCTCGAGAAGTTCATGAAAGGAGAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153099
PRSS42 MISSION shRNA shRNA Plasmid DNA
protease, serine, 42
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000032629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153099.1-532s1c1
Sequence:CCGGCCCTGTGAATTTCACCACTAACTCGAGTTAGTGGTGAAATTCACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153099.1-472s1c1
Sequence:CCGGCCCTAAGTTCTCAACAACTATCTCGAGATAGTTGTTGAGAACTTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153099.1-367s1c1
Sequence:CCGGCCATTGTATTTACAGCCGAATCTCGAGATTCGGCTGTAAATACAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153099.1-771s1c1
Sequence:CCGGGTGGCTATAAAGAAAGAGGAACTCGAGTTCCTCTTTCTTTATAGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153099.1-196s1c1
Sequence:CCGGCCGCTCTCCTTTCATGAACTTCTCGAGAAGTTCATGAAAGGAGAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153099
PRSS42 MISSION shRNA Lentiviral Transduction Particles
protease, serine, 42
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000032629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153099.1-532s1c1
Sequence:CCGGCCCTGTGAATTTCACCACTAACTCGAGTTAGTGGTGAAATTCACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153099.1-472s1c1
Sequence:CCGGCCCTAAGTTCTCAACAACTATCTCGAGATAGTTGTTGAGAACTTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153099.1-367s1c1
Sequence:CCGGCCATTGTATTTACAGCCGAATCTCGAGATTCGGCTGTAAATACAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153099.1-771s1c1
Sequence:CCGGGTGGCTATAAAGAAAGAGGAACTCGAGTTCCTCTTTCTTTATAGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153099.1-196s1c1
Sequence:CCGGCCGCTCTCCTTTCATGAACTTCTCGAGAAGTTCATGAAAGGAGAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks