EMAIL THIS PAGE TO A FRIEND

PRSS44

protease, serine, 44

Synonyms: TESSP-4 TESSP4
UniProtKB ID: E7EML9
Gene ID:
Mouse(73336) protease, serine, 44
Rat(501060) protease, serine, 44
domestic cat(101095475) protease, serine, 44
cow(100140621) protease, serine, 44
60 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_148940 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_148940 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_148940 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU063331 MISSION® esiRNA esiRNA targeting mouse 1700036D21Rik (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001131213 Rosetta Predictions human pricing
XM_001717247 Rosetta Predictions human pricing
XM_001718484 Rosetta Predictions human pricing
NM_001109298 Rosetta Predictions rat pricing
NM_148940 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001131213 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00388081 predicted 249
2 SASI_Hs02_00388082 predicted 267
3 SASI_Hs02_00388083 predicted 264
4 SASI_Hs02_00388084 predicted 272
5 SASI_Hs02_00388085 predicted 285
6 SASI_Hs02_00388086 predicted 259
7 SASI_Hs02_00388087 predicted 260
8 SASI_Hs02_00388088 predicted 269
9 SASI_Hs02_00388089 predicted 271
10 SASI_Hs02_00388090 predicted 243
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001717247 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00416008 predicted 1356
2 SASI_Hs02_00416009 predicted 487
3 SASI_Hs02_00416010 predicted 1563
4 SASI_Hs02_00416011 predicted 378
5 SASI_Hs02_00416012 predicted 568
6 SASI_Hs02_00416013 predicted 1509
7 SASI_Hs02_00416014 predicted 1361
8 SASI_Hs02_00416015 predicted 1684
9 SASI_Hs02_00416016 predicted 571
10 SASI_Hs02_00416017 predicted 520
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001718484 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00424222 predicted 501
2 SASI_Hs02_00424223 predicted 403
3 SASI_Hs02_00424224 predicted 485
4 SASI_Hs02_00424225 predicted 487
5 SASI_Hs02_00424226 predicted 429
6 SASI_Hs02_00424227 predicted 380
7 SASI_Hs02_00424228 predicted 571
8 SASI_Hs02_00424229 predicted 579
9 SASI_Hs02_00424230 predicted 447
10 SASI_Hs02_00424231 predicted 365
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109298 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00247044 predicted 809
2 SASI_Rn02_00247045 predicted 815
3 SASI_Rn02_00247046 predicted 302
4 SASI_Rn02_00247047 predicted 817
5 SASI_Rn02_00247048 predicted 678
6 SASI_Rn02_00247049 predicted 346
7 SASI_Rn02_00247050 predicted 1016
8 SASI_Rn02_00247051 predicted 266
9 SASI_Rn02_00247052 predicted 535
10 SASI_Rn02_00247053 predicted 564
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_148940 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00134738 predicted 775
2 SASI_Mm02_00342748 predicted 1212
3 SASI_Mm02_00342749 predicted 468
4 SASI_Mm01_00134740 predicted 646
5 SASI_Mm01_00134741 predicted 752
6 SASI_Mm01_00134742 predicted 773
7 SASI_Mm02_00342750 predicted 1238
8 SASI_Mm02_00342751 predicted 1006
9 SASI_Mm02_00342752 predicted 1083
10 SASI_Mm01_00134745 predicted 807
11 SASI_Mm01_00134739 predicted 471
12 SASI_Mm01_00134743 predicted 981
13 SASI_Mm01_00134744 predicted 819
14 SASI_Mm01_00134746 predicted 929
15 SASI_Mm01_00134747 predicted 671
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_148940
PRSS44 MISSION shRNA Bacterial Glycerol Stock
protease, serine, 44
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000032472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148940.1-726s1c1
Sequence:CCGGGCAGGAGATTGAGCTGAATATCTCGAGATATTCAGCTCAATCTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148940.1-594s1c1
Sequence:CCGGCCCTGTGAATTACAGCGTCAACTCGAGTTGACGCTGTAATTCACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148940.1-768s1c1
Sequence:CCGGCCAGATTCTCAAGGACATCATCTCGAGATGATGTCCTTGAGAATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148940.1-962s1c1
Sequence:CCGGGAGTTTATACAGAAGTGGCATCTCGAGATGCCACTTCTGTATAAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148940.1-946s1c1
Sequence:CCGGCGAATTGGATACCCTGGAGTTCTCGAGAACTCCAGGGTATCCAATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000452977    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148940.3-263s21c1
Sequence:CCGGCCCTTGATTCGATGGCATTTACTCGAGTAAATGCCATCGAATCAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000448105    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_148940.3-1547s21c1
Sequence:CCGGGGCACTGGGTCTGTCTATTAGCTCGAGCTAATAGACAGACCCAGTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000450218    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_148940.3-1511s21c1
Sequence:CCGGGGCACCGGGTCTAACTGATTTCTCGAGAAATCAGTTAGACCCGGTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_148940
PRSS44 MISSION shRNA shRNA Plasmid DNA
protease, serine, 44
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000032472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148940.1-726s1c1
Sequence:CCGGGCAGGAGATTGAGCTGAATATCTCGAGATATTCAGCTCAATCTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148940.1-594s1c1
Sequence:CCGGCCCTGTGAATTACAGCGTCAACTCGAGTTGACGCTGTAATTCACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148940.1-768s1c1
Sequence:CCGGCCAGATTCTCAAGGACATCATCTCGAGATGATGTCCTTGAGAATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148940.1-962s1c1
Sequence:CCGGGAGTTTATACAGAAGTGGCATCTCGAGATGCCACTTCTGTATAAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148940.1-946s1c1
Sequence:CCGGCGAATTGGATACCCTGGAGTTCTCGAGAACTCCAGGGTATCCAATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000452977    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148940.3-263s21c1
Sequence:CCGGCCCTTGATTCGATGGCATTTACTCGAGTAAATGCCATCGAATCAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000448105    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_148940.3-1547s21c1
Sequence:CCGGGGCACTGGGTCTGTCTATTAGCTCGAGCTAATAGACAGACCCAGTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000450218    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_148940.3-1511s21c1
Sequence:CCGGGGCACCGGGTCTAACTGATTTCTCGAGAAATCAGTTAGACCCGGTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_148940
PRSS44 MISSION shRNA Lentiviral Transduction Particles
protease, serine, 44
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000032472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148940.1-726s1c1
Sequence:CCGGGCAGGAGATTGAGCTGAATATCTCGAGATATTCAGCTCAATCTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148940.1-594s1c1
Sequence:CCGGCCCTGTGAATTACAGCGTCAACTCGAGTTGACGCTGTAATTCACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148940.1-768s1c1
Sequence:CCGGCCAGATTCTCAAGGACATCATCTCGAGATGATGTCCTTGAGAATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148940.1-962s1c1
Sequence:CCGGGAGTTTATACAGAAGTGGCATCTCGAGATGCCACTTCTGTATAAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_148940.1-946s1c1
Sequence:CCGGCGAATTGGATACCCTGGAGTTCTCGAGAACTCCAGGGTATCCAATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000452977    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148940.3-263s21c1
Sequence:CCGGCCCTTGATTCGATGGCATTTACTCGAGTAAATGCCATCGAATCAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000448105    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_148940.3-1547s21c1
Sequence:CCGGGGCACTGGGTCTGTCTATTAGCTCGAGCTAATAGACAGACCCAGTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000450218    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_148940.3-1511s21c1
Sequence:CCGGGGCACCGGGTCTAACTGATTTCTCGAGAAATCAGTTAGACCCGGTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks