EMAIL THIS PAGE TO A FRIEND

PRSS45

protease, serine, 45

Synonyms: TESSP5
UniProtKB ID: Q7RTY3, A3KN77
Gene ID:
Mouse(260408) protease, serine, 45
Rat(408244) protease, serine, 45
naked mole-rat(101717781) protease, serine, 45
cow(540798) protease, serine, 45
sheep(101115913) protease, serine, 45
dog(476645) protease, serine, 45
domestic cat(101094990) protease, serine, 45
52 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_199183 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_199183 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_199183 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_153172 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153172 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153172 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU063581 MISSION® esiRNA esiRNA human AC134504.2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_199183 Rosetta Predictions human pricing
NM_001008864 Rosetta Predictions rat pricing
NM_153172 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199183 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00372628 predicted 244
2 SASI_Hs01_00147983 predicted 407
3 SASI_Hs01_00147984 predicted 318
4 SASI_Hs02_00372629 predicted 580
5 SASI_Hs01_00147985 predicted 359
6 SASI_Hs01_00147986 predicted 345
7 SASI_Hs01_00147987 predicted 339
8 SASI_Hs02_00372630 predicted 572
9 SASI_Hs02_00372631 predicted 558
10 SASI_Hs02_00372632 predicted 540
11 SASI_Hs01_00147982 predicted 276
12 SASI_Hs01_00147988 predicted 453
13 SASI_Hs01_00147989 predicted 267
14 SASI_Hs01_00147990 predicted 243
15 SASI_Hs01_00147991 predicted 326
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008864 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00111751 predicted 616
2 SASI_Rn01_00111752 predicted 759
3 SASI_Rn02_00199390 predicted 612
4 SASI_Rn01_00111754 predicted 401
5 SASI_Rn01_00111755 predicted 580
6 SASI_Rn01_00111756 predicted 503
7 SASI_Rn01_00111757 predicted 554
8 SASI_Rn01_00111758 predicted 215
9 SASI_Rn01_00111759 predicted 587
10 SASI_Rn02_00199391 predicted 765
11 SASI_Rn01_00111750 predicted 771
12 SASI_Rn01_00111753 predicted 439
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153172 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00152860 predicted 260
2 SASI_Mm01_00152861 predicted 844
3 SASI_Mm01_00152862 predicted 627
4 SASI_Mm01_00152863 predicted 617
5 SASI_Mm01_00152864 predicted 438
6 SASI_Mm01_00152865 predicted 319
7 SASI_Mm01_00152867 predicted 340
8 SASI_Mm02_00343099 predicted 314
9 SASI_Mm01_00152868 predicted 720
10 SASI_Mm01_00152869 predicted 640
11 SASI_Mm01_00152866 predicted 459
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_199183
PRSS45 MISSION shRNA Bacterial Glycerol Stock
protease, serine, 45
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000420779    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_199183.2-739s21c1
Sequence:CCGGGGTTTGACCAAGGTCATGTGTCTCGAGACACATGACCTTGGTCAAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417716    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199183.2-416s21c1
Sequence:CCGGTGATCTGTGCCACCAATTATGCTCGAGCATAATTGGTGGCACAGATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199183.1-456s1c1
Sequence:CCGGCCGGCATTACAAGAAGTCCTTCTCGAGAAGGACTTCTTGTAATGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199183.1-625s1c1
Sequence:CCGGGCCTGCGTGAAGGCACAGAATCTCGAGATTCTGTGCCTTCACGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199183.1-315s1c1
Sequence:CCGGGCCCAATTTCAACCTGAAGGTCTCGAGACCTTCAGGTTGAAATTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199183.1-261s1c1
Sequence:CCGGCCTTCAAACACCTGTCACCTTCTCGAGAAGGTGACAGGTGTTTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199183.1-229s1c1
Sequence:CCGGGCCTTCATCATGGGTGACGTTCTCGAGAACGTCACCCATGATGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_199183
PRSS45 MISSION shRNA shRNA Plasmid DNA
protease, serine, 45
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000420779    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_199183.2-739s21c1
Sequence:CCGGGGTTTGACCAAGGTCATGTGTCTCGAGACACATGACCTTGGTCAAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417716    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199183.2-416s21c1
Sequence:CCGGTGATCTGTGCCACCAATTATGCTCGAGCATAATTGGTGGCACAGATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199183.1-456s1c1
Sequence:CCGGCCGGCATTACAAGAAGTCCTTCTCGAGAAGGACTTCTTGTAATGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199183.1-625s1c1
Sequence:CCGGGCCTGCGTGAAGGCACAGAATCTCGAGATTCTGTGCCTTCACGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199183.1-315s1c1
Sequence:CCGGGCCCAATTTCAACCTGAAGGTCTCGAGACCTTCAGGTTGAAATTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199183.1-261s1c1
Sequence:CCGGCCTTCAAACACCTGTCACCTTCTCGAGAAGGTGACAGGTGTTTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199183.1-229s1c1
Sequence:CCGGGCCTTCATCATGGGTGACGTTCTCGAGAACGTCACCCATGATGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_199183
PRSS45 MISSION shRNA Lentiviral Transduction Particles
protease, serine, 45
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000420779    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_199183.2-739s21c1
Sequence:CCGGGGTTTGACCAAGGTCATGTGTCTCGAGACACATGACCTTGGTCAAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417716    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199183.2-416s21c1
Sequence:CCGGTGATCTGTGCCACCAATTATGCTCGAGCATAATTGGTGGCACAGATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199183.1-456s1c1
Sequence:CCGGCCGGCATTACAAGAAGTCCTTCTCGAGAAGGACTTCTTGTAATGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199183.1-625s1c1
Sequence:CCGGGCCTGCGTGAAGGCACAGAATCTCGAGATTCTGTGCCTTCACGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199183.1-315s1c1
Sequence:CCGGGCCCAATTTCAACCTGAAGGTCTCGAGACCTTCAGGTTGAAATTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199183.1-261s1c1
Sequence:CCGGCCTTCAAACACCTGTCACCTTCTCGAGAAGGTGACAGGTGTTTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199183.1-229s1c1
Sequence:CCGGGCCTTCATCATGGGTGACGTTCTCGAGAACGTCACCCATGATGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153172
PRSS45 MISSION shRNA Bacterial Glycerol Stock
protease, serine, 45
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000033099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153172.1-140s1c1
Sequence:CCGGCGGCCAAACTTAGGTTATAATCTCGAGATTATAACCTAAGTTTGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153172.1-401s1c1
Sequence:CCGGCCCGTGGGTGACATCATTATTCTCGAGAATAATGATGTCACCCACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153172.1-657s1c1
Sequence:CCGGACAAGAATTGTGACAGCATTTCTCGAGAAATGCTGTCACAATTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153172.1-877s1c1
Sequence:CCGGCCGTATCACCAAATATACCATCTCGAGATGGTATATTTGGTGATACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153172.1-240s1c1
Sequence:CCGGCGAGCCTTCAGATAGAAGATACTCGAGTATCTTCTATCTGAAGGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153172
PRSS45 MISSION shRNA shRNA Plasmid DNA
protease, serine, 45
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000033099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153172.1-140s1c1
Sequence:CCGGCGGCCAAACTTAGGTTATAATCTCGAGATTATAACCTAAGTTTGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153172.1-401s1c1
Sequence:CCGGCCCGTGGGTGACATCATTATTCTCGAGAATAATGATGTCACCCACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153172.1-657s1c1
Sequence:CCGGACAAGAATTGTGACAGCATTTCTCGAGAAATGCTGTCACAATTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153172.1-877s1c1
Sequence:CCGGCCGTATCACCAAATATACCATCTCGAGATGGTATATTTGGTGATACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153172.1-240s1c1
Sequence:CCGGCGAGCCTTCAGATAGAAGATACTCGAGTATCTTCTATCTGAAGGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153172
PRSS45 MISSION shRNA Lentiviral Transduction Particles
protease, serine, 45
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000033099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153172.1-140s1c1
Sequence:CCGGCGGCCAAACTTAGGTTATAATCTCGAGATTATAACCTAAGTTTGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153172.1-401s1c1
Sequence:CCGGCCCGTGGGTGACATCATTATTCTCGAGAATAATGATGTCACCCACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153172.1-657s1c1
Sequence:CCGGACAAGAATTGTGACAGCATTTCTCGAGAAATGCTGTCACAATTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153172.1-877s1c1
Sequence:CCGGCCGTATCACCAAATATACCATCTCGAGATGGTATATTTGGTGATACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153172.1-240s1c1
Sequence:CCGGCGAGCCTTCAGATAGAAGATACTCGAGTATCTTCTATCTGAAGGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks