EMAIL THIS PAGE TO A FRIEND

PRSS55

protease, serine, 55

Synonyms: T-SP1 TSP1 UNQ9391
UniProtKB ID: Q6UWB4, E5RJX5
Gene ID:
Human(203074) Summary: This gene encodes a member of a group of membrane-anchored chymotrypsin (S1)-like serine proteases. The enocoded protein is primarily expressed in the Leydig and Sertoli cells of the testis and may be involved in male fertility. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2010]
Mouse(71037) protease, serine, 55
Rat(683415) protease, serine, 55
chicken(428663) protease, serine, 55
domestic cat(101085119) protease, serine, 55
dog(477368) protease, serine, 55
cow(521059) protease, serine, 55
sheep(101110127) protease, serine, 55
naked mole-rat(101702750) protease, serine, 55
domestic guinea pig(100718454) protease, serine, 55
109 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001081063 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081063 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081063 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_198464 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198464 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198464 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_127824 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_127824 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_127824 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_198464 Rosetta Predictions human pricing
XM_001065830 Rosetta Predictions rat pricing
NM_001081063 Rosetta Predictions mouse pricing
XM_127824 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198464 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00156050 predicted 867
2 SASI_Hs01_00156051 predicted 595
3 SASI_Hs01_00156052 predicted 506
4 SASI_Hs02_00371992 predicted 641
5 SASI_Hs01_00156053 predicted 666
6 SASI_Hs01_00156054 predicted 592
7 SASI_Hs01_00156058 predicted 804
8 SASI_Hs01_00156055 predicted 706
9 SASI_Hs01_00156056 predicted 659
10 SASI_Hs01_00156057 predicted 277
11 SASI_Hs01_00156059 predicted 264
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001065830 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00315484 predicted 760
2 SASI_Rn02_00315485 predicted 267
3 SASI_Rn02_00315486 predicted 316
4 SASI_Rn02_00315487 predicted 545
5 SASI_Rn02_00315488 predicted 486
6 SASI_Rn02_00315489 predicted 322
7 SASI_Rn02_00315490 predicted 479
8 SASI_Rn02_00315491 predicted 254
9 SASI_Rn02_00315492 predicted 646
10 SASI_Rn02_00315493 predicted 688
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081063 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00294811 predicted 614
2 SASI_Mm02_00294812 predicted 614
3 SASI_Mm02_00294813 predicted 366
4 SASI_Mm02_00294814 predicted 525
5 SASI_Mm02_00294815 predicted 575
6 SASI_Mm02_00294816 predicted 294
7 SASI_Mm02_00294817 predicted 506
8 SASI_Mm02_00294818 predicted 337
9 SASI_Mm02_00294819 predicted 313
10 SASI_Mm02_00294820 predicted 531
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_127824 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00230713 predicted 375
2 SASI_Mm01_00230714 predicted 294
3 SASI_Mm01_00230715 predicted 304
4 SASI_Mm01_00230716 predicted 529
5 SASI_Mm01_00230717 predicted 296
6 SASI_Mm01_00230718 predicted 506
7 SASI_Mm01_00230719 predicted 344
8 SASI_Mm01_00230720 predicted 388
9 SASI_Mm01_00230721 predicted 317
10 SASI_Mm01_00230722 predicted 535
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081063
PRSS55 MISSION shRNA Bacterial Glycerol Stock
protease, serine, 55
Mouse
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000452914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081063.1-299s21c1
Sequence:CCGGGAACCAATGACTTAACTACTTCTCGAGAAGTAGTTAAGTCATTGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000445268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081063.1-885s21c1
Sequence:CCGGGAACAATCAGCTCTCCAAATCCTCGAGGATTTGGAGAGCTGATTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000445481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081063.1-635s21c1
Sequence:CCGGATGGTAATGAGAGCTACGATGCTCGAGCATCGTAGCTCTCATTACCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081063
PRSS55 MISSION shRNA shRNA Plasmid DNA
protease, serine, 55
Mouse
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000452914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081063.1-299s21c1
Sequence:CCGGGAACCAATGACTTAACTACTTCTCGAGAAGTAGTTAAGTCATTGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000445268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081063.1-885s21c1
Sequence:CCGGGAACAATCAGCTCTCCAAATCCTCGAGGATTTGGAGAGCTGATTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000445481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081063.1-635s21c1
Sequence:CCGGATGGTAATGAGAGCTACGATGCTCGAGCATCGTAGCTCTCATTACCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081063
PRSS55 MISSION shRNA Lentiviral Transduction Particles
protease, serine, 55
Mouse
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000452914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081063.1-299s21c1
Sequence:CCGGGAACCAATGACTTAACTACTTCTCGAGAAGTAGTTAAGTCATTGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000445268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081063.1-885s21c1
Sequence:CCGGGAACAATCAGCTCTCCAAATCCTCGAGGATTTGGAGAGCTGATTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000445481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081063.1-635s21c1
Sequence:CCGGATGGTAATGAGAGCTACGATGCTCGAGCATCGTAGCTCTCATTACCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198464
PRSS55 MISSION shRNA Bacterial Glycerol Stock
protease, serine, 55
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000420457    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198464.2-169s21c1
Sequence:CCGCGAATGTGGTGACAGATCTATTCTCGAGAATAGATCTGTCACCACATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198464.2-637s21c1
Sequence:CCGGGATCTGATGAAAGCGCCAATGCTCGAGCATTGGCGCTTTCATCAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432739    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198464.2-1046s21c1
Sequence:CCGGATGTGTTGTTCAGAGCTATTTCTCGAGAAATAGCTCTGAACAACACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198464.1-396s1c1
Sequence:CCGGCGACTTAACTAGCCCATCCATCTCGAGATGGATGGGCTAGTTAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198464.1-260s1c1
Sequence:CCGGAGGTGAGTATTCAGGCAAGAACTCGAGTTCTTGCCTGAATACTCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198464.1-450s1c1
Sequence:CCGGCAAAGACTTTAAGAGAGCCAACTCGAGTTGGCTCTCTTAAAGTCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198464.1-858s1c1
Sequence:CCGGCCCAGGGATATACACCTCGTTCTCGAGAACGAGGTGTATATCCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198464.1-723s1c1
Sequence:CCGGCGGATACAAGAATGAGAGCTACTCGAGTAGCTCTCATTCTTGTATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198464
PRSS55 MISSION shRNA shRNA Plasmid DNA
protease, serine, 55
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000420457    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198464.2-169s21c1
Sequence:CCGCGAATGTGGTGACAGATCTATTCTCGAGAATAGATCTGTCACCACATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198464.2-637s21c1
Sequence:CCGGGATCTGATGAAAGCGCCAATGCTCGAGCATTGGCGCTTTCATCAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432739    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198464.2-1046s21c1
Sequence:CCGGATGTGTTGTTCAGAGCTATTTCTCGAGAAATAGCTCTGAACAACACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198464.1-396s1c1
Sequence:CCGGCGACTTAACTAGCCCATCCATCTCGAGATGGATGGGCTAGTTAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198464.1-260s1c1
Sequence:CCGGAGGTGAGTATTCAGGCAAGAACTCGAGTTCTTGCCTGAATACTCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198464.1-450s1c1
Sequence:CCGGCAAAGACTTTAAGAGAGCCAACTCGAGTTGGCTCTCTTAAAGTCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198464.1-858s1c1
Sequence:CCGGCCCAGGGATATACACCTCGTTCTCGAGAACGAGGTGTATATCCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198464.1-723s1c1
Sequence:CCGGCGGATACAAGAATGAGAGCTACTCGAGTAGCTCTCATTCTTGTATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198464
PRSS55 MISSION shRNA Lentiviral Transduction Particles
protease, serine, 55
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000420457    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198464.2-169s21c1
Sequence:CCGCGAATGTGGTGACAGATCTATTCTCGAGAATAGATCTGTCACCACATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198464.2-637s21c1
Sequence:CCGGGATCTGATGAAAGCGCCAATGCTCGAGCATTGGCGCTTTCATCAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432739    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198464.2-1046s21c1
Sequence:CCGGATGTGTTGTTCAGAGCTATTTCTCGAGAAATAGCTCTGAACAACACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198464.1-396s1c1
Sequence:CCGGCGACTTAACTAGCCCATCCATCTCGAGATGGATGGGCTAGTTAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198464.1-260s1c1
Sequence:CCGGAGGTGAGTATTCAGGCAAGAACTCGAGTTCTTGCCTGAATACTCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198464.1-450s1c1
Sequence:CCGGCAAAGACTTTAAGAGAGCCAACTCGAGTTGGCTCTCTTAAAGTCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198464.1-858s1c1
Sequence:CCGGCCCAGGGATATACACCTCGTTCTCGAGAACGAGGTGTATATCCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198464.1-723s1c1
Sequence:CCGGCGGATACAAGAATGAGAGCTACTCGAGTAGCTCTCATTCTTGTATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_127824
PRSS55 MISSION shRNA Bacterial Glycerol Stock
protease, serine, 55
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000032974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127824.1-527s1c1
Sequence:CCGGCCAACTCAACTGACAAGGAATCTCGAGATTCCTTGTCAGTTGAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127824.1-802s1c1
Sequence:CCGGGCAAAGTATACCCTGTGGATTCTCGAGAATCCACAGGGTATACTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127824.1-780s1c1
Sequence:CCGGCCCAGGGATATATACTGTATTCTCGAGAATACAGTATATATCCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127824.1-580s1c1
Sequence:CCGGCGTATCATAGAGTGGGAGGAACTCGAGTTCCTCCCACTCTATGATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127824.1-355s1c1
Sequence:CCGGACCACCATAATCCGGCACAAACTCGAGTTTGTGCCGGATTATGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_127824
PRSS55 MISSION shRNA shRNA Plasmid DNA
protease, serine, 55
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000032974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127824.1-527s1c1
Sequence:CCGGCCAACTCAACTGACAAGGAATCTCGAGATTCCTTGTCAGTTGAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127824.1-802s1c1
Sequence:CCGGGCAAAGTATACCCTGTGGATTCTCGAGAATCCACAGGGTATACTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127824.1-780s1c1
Sequence:CCGGCCCAGGGATATATACTGTATTCTCGAGAATACAGTATATATCCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127824.1-580s1c1
Sequence:CCGGCGTATCATAGAGTGGGAGGAACTCGAGTTCCTCCCACTCTATGATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127824.1-355s1c1
Sequence:CCGGACCACCATAATCCGGCACAAACTCGAGTTTGTGCCGGATTATGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_127824
PRSS55 MISSION shRNA Lentiviral Transduction Particles
protease, serine, 55
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000032974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127824.1-527s1c1
Sequence:CCGGCCAACTCAACTGACAAGGAATCTCGAGATTCCTTGTCAGTTGAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127824.1-802s1c1
Sequence:CCGGGCAAAGTATACCCTGTGGATTCTCGAGAATCCACAGGGTATACTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127824.1-780s1c1
Sequence:CCGGCCCAGGGATATATACTGTATTCTCGAGAATACAGTATATATCCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127824.1-580s1c1
Sequence:CCGGCGTATCATAGAGTGGGAGGAACTCGAGTTCCTCCCACTCTATGATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127824.1-355s1c1
Sequence:CCGGACCACCATAATCCGGCACAAACTCGAGTTTGTGCCGGATTATGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks